Previous Contig 000317:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G01Sequence466000317 (2)sp|Q9M0Y6|DPNM_ARATH8e-23Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph710008432 (2)sp|Q9M0Y6|DPNM_ARATH2e-58Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph
JMSF006P13Sequence248000317 (2)260010081 (2)pir|T09796|T097962e-05drought-induced major intrinsic protein PIPc - Craterostigma plantagineum>gb:CPP

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006G01+ TCCAAGCTAACTAAAGCCTGCACTCCAAAATCTGCAACAGTCACTG
                      ____________________________________________________________
consensus TCCAAGCTAACTAAAGCCTGCACTCCAAAATCTGCAACAGTCACTG
 
. : . : . : . : . : . :
JMFF006G01+ GGGTCTGGTCATTTTTCTCAAGAATTTGTCCATCACCATCACTGGAGAGCAATGACTTCT
                      ____________________________________________________________
consensus GGGTCTGGTCATTTTTCTCAAGAATTTGTCCATCACCATCACTGGAGAGCAATGACTTCT
 
. : . : . : . : . : . :
JMFF006G01+ TAACATCAACGCAGAGACGACAAGCTCTCTCTACAACATCCACGGCTGCCTCGAGCTCTT
                      ____________________________________________________________
consensus TAACATCAACGCAGAGACGACAAGCTCTCTCTACAACATCCACGGCTGCCTCGAGCTCTT
 
. : . : . : . : . : . :
JMSF006P13+ CTCACGGTGAAGC
JMFF006G01+ TGTAGTATTTCGCTTTCTGCTCCGAAAGCGGAAGCCTCGAACTCAACCTCACGGTGAAGC
                      ____________________________________________________________
consensus TGTAGTATTTCGCTTTCTGCTCCGAAAGCGGAAGCCTCGAACTCAACCTCACGGTGAAGC
 
. : . : . : . : . : . :
JMSF006P13+ AGCGCCGGCGGGGAGGCTGATCGAACGGACGGCATGGATGAGCTTTGGGGAATCGAACGG
JMFF006G01+ AGCGCCGGCGGGGAGGCTGATCGAACGGACGGCATGGATGAGCTTTGGGGAATCGAACGG
                      ____________________________________________________________
consensus AGCGCCGGCGGGGAGGCTGATCGAACGGACGGCATGGATGAGCTTTGGGGAATCGAACGG
 
. : . : . : . : . : . :
JMSF006P13+ CGGAGTAGCGGAGAAGATCCATTGCAGGAGAGAATCAAACGGTAAAGGAAGCTGCGAATG
JMFF006G01+ CGGAGTAGCGGAGAAGATCCATTGCAGGAGAGAATCAAACGGTAAAGGAAGCTGCTAATG
                      ____________________________________________________________
consensus CGGAGTAGCGGAGAAGATCCATTGCAGGAGAGAATCAAACGGTAAAGGAAGCTGCTAATG
 
. : . : . : . : . : . :
JMSF006P13+ GAATATGCTATATTTAATGTTTAATGTTCATTATATGATGAGAAACGCCGACTCCTAACG
JMFF006G01+ GAATATGCTATATTTAATGTTTAATGTTCATTATATGATGAGAAACGCCGACTCCTAACG
                      ____________________________________________________________
consensus GAATATGCTATATTTAATGTTTAATGTTCATTATATGATGAGAAACGCCGACTCCTAACG
 
. : . : . : . : . : . :
JMSF006P13+ GCGAAGAGTATAATGGCGGCCTGCGGGGATAGATTGAGCAGCCCGGTGACAGTT
JMFF006G01+ GCGAAGAGTATAACGGCGGCCTGCGGGGATAGATTGAGCAGCCCGGTGACAGTTGAGTCC
                      ____________________________________________________________
consensus GCGAAGAGTATAATGGCGGCCTGCGGGGATAGATTGAGCAGCCCGGTGACAGTTGAGTCC