Previous Contig 000316:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006F21Sequence590000316 (10)gb:AC135205_17420191e-27Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se553000316 (10)gb:AC135205_17420194e-27Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se
JMFF031E12Sequence574000316 (10)gb:AC135205_17420192e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se699000316 (10)gb:AC135205_17420192e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se
JMFF037E18Sequence576000316 (10)gb:AC135205_17420192e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se716000316 (10)gb:AC135205_17420193e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se
JMFN007G08Sequence618000316 (10)gb:AC135205_17420192e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se
JMFN037J15Sequence643000316 (10)gb:AC135205_17420192e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se
JMSF046D19Sequence733000316 (10)gb:AC135205_17420193e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se736000316 (10)gb:AC135205_17420193e-36Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006F21- CGGAGAATAATTTA
                      ____________________________________________________________
consensus CGGAGAATAATTTA
 
. : . : . : . : . : . :
rJMFF006F21- AATATAAGTTGGAGGAACATGAATACATAGATTGTGAAATACTACCAATACAATATTTAG
rJMSF046D19- ACATGAATACATAGATTGTGAAATACTACCAATACAATATTTAG
rJMFF037E18- TAGATTGTGAAATACTACCAATACAATATTTAG
JMSF046D19+ ACATGAATACATAGATTGTGAAATACTACCAATACAATATTTAG
                      ____________________________________________________________
consensus AATATAAGTTGGAGGAACATGAATACATAGATTGTGAAATACTACCAATACAATATTTAG
 
. : . : . : . : . : . :
rJMFF006F21- AAATCACAGGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
rJMSF046D19- AAATCACAGGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
rJMFF037E18- AAATCACAGGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
JMSF046D19+ AAATCACAGGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
JMFN037J15+ CATTGAAGTTCATCGG
JMFN007G08+ TAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
rJMFF031E12- GGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
                      ____________________________________________________________
consensus AAATCACAGGAATTATTCTAAATGTAATTATTGTCATAGCAATACATTGAAGTTCATCGG
 
. : . : . : . : . : . :
rJMFF006F21- AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
rJMSF046D19- AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
rJMFF037E18- AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
JMFF037E18+ CTTCTTTCAATTG
JMSF046D19+ AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
JMFN037J15+ AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
JMFN007G08+ AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
JMFF031E12+ TTCTTTCAATTG
rJMFF031E12- AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
                      ____________________________________________________________
consensus AAAATGCAGAATTGTAACATTAGACGTCTCACACTAAACGTCTCACTCTTCTTTCAATTG
 
. : . : . : . : . : . :
rJMFF006F21- TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
rJMSF046D19- TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
rJMFF037E18- TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
JMFF037E18+ TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
JMSF046D19+ TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
JMFN037J15+ TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
JMFN007G08+ TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
JMFF031E12+ TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
rJMFF031E12- TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
                      ____________________________________________________________
consensus TCACTTCTACTTGGTTTGTCTGAGATAAAGTTGATTGCATCGGCGGGAGCCGGAATCCAT
 
. : . : . : . : . : . :
rJMFF006F21- TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
rJMSF046D19- TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
rJMFF037E18- TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMFF037E18+ TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMSF046D19+ TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMFN037J15+ TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMFN007G08+ TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMFF031E12+ TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
rJMFF031E12- TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
JMFF006F21+ CCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
                      ____________________________________________________________
consensus TCATTGGTGGCCGGATTTCCCTTGCAGGAGGCATGAAACTCGGCATCAGAATCAGGTTCT
 
. : . : . : . : . : . :
rJMFF006F21- ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
rJMSF046D19- ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
rJMFF037E18- ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMFF037E18+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMSF046D19+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMFN037J15+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMFN007G08+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMFF031E12+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
rJMFF031E12- ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
JMFF006F21+ ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
                      ____________________________________________________________
consensus ATTTTGAAGGAATTCGGCAATGCCCCCTCCACCTTTATAAATCCTGTTCCAGTCGTGTGG
 
. : . : . : . : . : . :
rJMFF006F21- TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
rJMSF046D19- TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
rJMFF037E18- TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMFF037E18+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMSF046D19+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMFN037J15+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMFN007G08+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMFF031E12+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
rJMFF031E12- TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
JMFF006F21+ TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
                      ____________________________________________________________
consensus TGTTGCTTGTCAACGCAATTCAGATCCTTGTAATACTCAGTTTCCACAAATTCCTCCCTC
 
. : . : . : . : . : . :
rJMFF006F21- AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGNTGAAATTGAAGG
rJMSF046D19- AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
rJMFF037E18- AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMFF037E18+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMSF046D19+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMFN037J15+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMFN007G08+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMFF031E12+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
rJMFF031E12- AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
JMFF006F21+ AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
                      ____________________________________________________________
consensus AATTGGCCTTCACTATAACATAATTTCTGTTGATCTTTTTCGAGGCGTTGAAATTGAAGG
 
. : . : . : . : . : . :
rJMFF006F21- AGTTCAGGGATTTCGCCGTCTCCATGAACGCNATTGAAATAGGTATCCGTATACGTAGA
rJMSF046D19- AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
rJMFF037E18- AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMFF037E18+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMSF046D19+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMFN037J15+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMFN007G08+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMFF031E12+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
rJMFF031E12- AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
JMFF006F21+ AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
                      ____________________________________________________________
consensus AGTTCAGGGATTTCGCCGTCTCCATGAACGCGATTGAAATAGGTATCCGTATACGTAGAA
 
. : . : . : . : . : . :
rJMSF046D19- GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
rJMFF037E18- GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMFF037E18+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMSF046D19+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMFN037J15+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMFN007G08+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMFF031E12+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
rJMFF031E12- GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
JMFF006F21+ GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
                      ____________________________________________________________
consensus GAGTAATCGCTTCTGTGTGGTTTAGAGTGGCGGTTTGGAGCTAAGTCATCGAAGTGCTTC
 
. : . : . : . : . : . :
rJMSF046D19- CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
rJMFF037E18- CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMFF037E18+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMSF046D19+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMFN037J15+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMFN007G08+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMFF031E12+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
rJMFF031E12- CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
JMFF006F21+ CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
                      ____________________________________________________________
consensus CTGGTGGCTTCCTCCATTGCAGCTTCTTCCTGCGCCGACAGATGAACATCGCTTCGGTTT
 
. : . : . : . : . : . :
rJMSF046D19- GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
rJMFF037E18- GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
JMFF037E18+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
JMSF046D19+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
JMFN037J15+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
JMFN007G08+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGA
JMFF031E12+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
rJMFF031E12- GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
JMFF006F21+ GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
                      ____________________________________________________________
consensus GGTTTGCCGCCGCAGCATGCCATTTCAATTCCTTGATTGATTTCGATCTTCACTTTTGCT
 
. : . : . : . : . : . :
rJMSF046D19- TTTCTGCCCTACTTTGATTCGA
rJMFF037E18- TTTCTGCCCTACTTTGATTC
JMFF037E18+ TTTCTGCCCTACTTTGATTC
JMSF046D19+ TTTCTGCCCTACTTTGATTCGA
JMFN037J15+ TTTCTGCCCTACTTTGATTCGA
JMFF031E12+ TTTCTGCCCTACTTTGATTCGA
rJMFF031E12- TTTCTGCCCTACTTTGATTCGAT
JMFF006F21+ TTTCTGCCCTACTTTGATTCGATGTTCTCTTCGATCTGATTGAATTAATTGGAATTAATA
                      ____________________________________________________________
consensus TTTCTGCCCTACTTTGATTCGATGTTCTCTTCGATCTGATTGAATTAATTGGAATTAATA
 
. : . : . : . : . : . :
JMFF006F21+ CCAGCTAGGGCTCACCAACTATGTAGCTTAATTGCCTAGATATTTTTCTTTTGGGAAGAT
                      ____________________________________________________________
consensus CCAGCTAGGGCTCACCAACTATGTAGCTTAATTGCCTAGATATTTTTCTTTTGGGAAGAT