Previous Contig 000309:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006F04Sequence582000309 (2)pir|T02431|T024312e-52acetyl-CoA carboxylase (EC 6.4.1.2), biotin carboxylase - common tobacco>gb:TOBB818008427 (2)pir|T07093|T07093e-102acetyl-CoA carboxylase (EC 6.4.1.2) biotin carboxylase chain precursor - soybean
JMFF014P02Sequence255000309 (2)744008427 (2)gb:AF163150_17735563e-86Glycine max acetyl-CoA carboxylase (accC-3) gene, complete cds; nuclear gene for

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006F04+ TTACAGCAGCAGATAAGACATTTTGGATCAACAAGTACGATT
                      ____________________________________________________________
consensus TTACAGCAGCAGATAAGACATTTTGGATCAACAAGTACGATT
 
. : . : . : . : . : . :
JMFF006F04+ GATTACTAGGAGCTTCACCAATGCAAACAGCCTCATCTGCAAGCTTCACATGAAGGGCAT
                      ____________________________________________________________
consensus GATTACTAGGAGCTTCACCAATGCAAACAGCCTCATCTGCAAGCTTCACATGAAGGGCAT
 
. : . : . : . : . : . :
JMFF006F04+ CTTTGTCTATGGTTGAGTAAACTGCAACACAAGGAATCCCCATTTCATGAGCAGTCCGAA
                      ____________________________________________________________
consensus CTTTGTCTATGGTTGAGTAAACTGCAACACAAGGAATCCCCATTTCATGAGCAGTCCGAA
 
. : . : . : . : . : . :
JMFF006F04+ TCACACGAACTGCAATTTCCCCTCTGTTTGCCACCAAGATTTTACCAGCCTGACATACTG
                      ____________________________________________________________
consensus TCACACGAACTGCAATTTCCCCTCTGTTTGCCACCAAGATTTTACCAGCCTGACATACTG
 
. : . : . : . : . : . :
JMFF006F04+ CACCAAGAGCTCCACCATATTTGCTAGATTTAGGACTAACTCTAGATGCTTGAAGCCTCT
                      ____________________________________________________________
consensus CACCAAGAGCTCCACCATATTTGCTAGATTTAGGACTAACTCTAGATGCTTGAAGCCTCT
 
. : . : . : . : . : . :
JMFF014P02+ TAATACTAG
JMFF006F04+ GTCGTGGAAAGTTTATCCTCTTTCCTACCGTAAAGCTACACTGAGAGCTACTAATACTAG
                      ____________________________________________________________
consensus GTCGTGGAAAGTTTATCCTCTTTCCTACCGTAAAGCTACACTGAGAGCTACTAATACTAG
 
. : . : . : . : . : . :
JMFF014P02+ TTCTCCCAATGAGTAAACCTGGGCGAAAAGGCGAGGAGGAGATAGATTTGGTGCAAAAGN
JMFF006F04+ TTCTCCCAATGAGTAAACCTGGGCGAAAAGGCGAGGAGGAGATAGATTTGGTGCAAAAGC
                      ____________________________________________________________
consensus TTCTCCCAATGAGTAAACCTGGGCGAAAAGGCGAGGAGGAGATAGATTTGGTGCAAAAGC
 
. : . : . : . : . : . :
JMFF014P02+ TAGTCGCGGCGGCAGATTCCATTCTCTCTGATCACTGCGGAATGCGTGCACGCGAGAGTG
JMFF006F04+ TAGTCGCGGCGGCAGATTCCATTCTCTCTGATCACTGCGGAATGCGTGCACGCGAGAGTG
                      ____________________________________________________________
consensus TAGTCGCGGCGGCAGATTCCATTCTCTCTGATCACTGCGGAATGCGTGCACGCGAGAGTG
 
. : . : . : . : . : . :
JMFF014P02+ AGAGAGAAAGAGAGGGGAGAGGAGATTTGAAGGAAGGAGCTGTCGATGAATACGAGGGAG
JMFF006F04+ AGAGAGAAAGAGAGGGGAGAGGAGATTTGAAGGAAGGAGCTGTCGATGAATACGAGGGAG
                      ____________________________________________________________
consensus AGAGAGAAAGAGAGGGGAGAGGAGATTTGAAGGAAGGAGCTGTCGATGAATACGAGGGAG
 
. : . : . : . : . : . :
JMFF014P02+ CGGCGAGTTGAATACTCCGCCAGAGCTGTTGTGAGAGATATGACTACTAGCTGTGTAGTT
JMFF006F04+ CGGCGAGTTGAATACTCCGCCAGAGCTGTTGTGAGAGATATGACTACTAGCTGTGTAGTT
                      ____________________________________________________________
consensus CGGCGAGTTGAATACTCCGCCAGAGCTGTTGTGAGAGATATGACTACTAGCTGTGTAGTT