Previous Contig 000304:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006E01Sequence574000304 (8)gb:AY118226_15794208e-09Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.636009760 (8)gb:AY118226_15794201e-51Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMFF033E09Sequence477000304 (8)gb:AY118226_15794203e-08Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.728009760 (8)gb:AY118226_15794203e-55Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMFS014E04Sequence615000304 (8)gb:AY118226_15794206e-21Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMSF011E13Sequence400000304 (8)gb:AY118226_15794205e-22Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.783009760 (8)gb:AY118226_15794203e-55Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMSF016O01Sequence337000304 (8)gb:AY118226_15794201e-07Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.781009760 (8)gb:AY118226_15794203e-55Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMSF030K01Sequence593000304 (8)gb:AY118226_15794206e-21Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.692009760 (8)gb:AY118226_15794207e-55Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMSF038E04Sequence677000304 (8)gb:AY118226_15794203e-56Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.886009760 (8)gb:AY118226_15794201e-62Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.
JMSF040H17Sequence647000304 (8)gb:AY118226_15794204e-24Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.859009760 (8)gb:AY118226_15794205e-60Arabidopsis thaliana RanGAP1 interacting protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038E04+ TTCCATGAGAGACCAGCA
                      ____________________________________________________________
consensus TTCCATGAGAGACCAGCA
 
. : . : . : . : . : . :
JMSF038E04+ TTCTGTTTCAGTGTCAAATGCCCACACTGAAACTTTATCACTTGCAGGATCAGTTTTCCC
                      ____________________________________________________________
consensus TTCTGTTTCAGTGTCAAATGCCCACACTGAAACTTTATCACTTGCAGGATCAGTTTTCCC
 
. : . : . : . : . : . :
JMSF038E04+ TCCAACCAGAAGCACTTTCTTCCCCCAAGAAACCAGAGAATGGCCCTTGCAAGCTGGGAT
                      ____________________________________________________________
consensus TCCAACCAGAAGCACTTTCTTCCCCCAAGAAACCAGAGAATGGCCCTTGCAAGCTGGGAT
 
. : . : . : . : . : . :
JMSF038E04+ TTTTAAGGGGAGACTGGTTGGTGAAAGGTAAAGCTTTGATGATACTGAAGTCCAGGAAAA
                      ____________________________________________________________
consensus TTTTAAGGGGAGACTGGTTGGTGAAAGGTAAAGCTTTGATGATACTGAAGTCCAGGAAAA
 
. : . : . : . : . : . :
JMSF038E04+ TCTATCAAAATTCAGCACCTGCACATCTTCTAATAGTCCACTCCCAGACTCACCTCCAAC
                      ____________________________________________________________
consensus TCTATCAAAATTCAGCACCTGCACATCTTCTAATAGTCCACTCCCAGACTCACCTCCAAC
 
. : . : . : . : . : . :
JMSF038E04+ TACTACCATCTTGTTCCCAACAACAGCTGCAGAATGATTGAAGCGAGGTATAGGTTTATC
JMSF011E13+ ATTGAAGCGAGGTATAGGTTTATC
JMFS014E04+ ATTGAAGCGAGGTATAGGTTTATC
JMSF040H17+ ATTGAAGCGAGGTATAGGTTTATC
JMSF030K01+ ATTGAAGCGAGGTATAGGTTTATC
                      ____________________________________________________________
consensus TACTACCATCTTGTTCCCAACAACAGCTGCAGAATGATTGAAGCGAGGTATAGGTTTATC
 
. : . : . : . : . : . :
JMSF038E04+ CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
JMSF011E13+ CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
JMFS014E04+ CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
JMSF040H17+ CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
JMSF030K01+ CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
JMFF006E01+ TTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
                      ____________________________________________________________
consensus CCCAGCAATAGAAAGGACCATCCAATTTTCAGAGCTTCCTGAAGTACAATTGTTAAACTC
 
. : . : . : . : . : . :
JMSF038E04+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMSF011E13+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMFS014E04+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMSF040H17+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMSF030K01+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMFF033E09+ ATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMSF016O01+ CCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
JMFF006E01+ TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
                      ____________________________________________________________
consensus TGATGCACCAGTAGAATGTTGGCAGCTGCTTTCTTCAGAATCGTTTATGCTATTGCCAAC
 
. : . : . : . : . : . :
JMSF038E04+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMSF011E13+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMFS014E04+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMSF040H17+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMSF030K01+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMFF033E09+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMSF016O01+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
JMFF006E01+ AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
                      ____________________________________________________________
consensus AGCTTCACCAGTTGAACTGCTAAAACGTTTTGGGTGCCTGATTGGACTTTTAGTTCCCTG
 
. : . : . : . : . : . :
JMSF038E04+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMSF011E13+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMFS014E04+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMSF040H17+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMSF030K01+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMFF033E09+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMSF016O01+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
JMFF006E01+ AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
                      ____________________________________________________________
consensus AGCAGTGTCTGAAAGTTGAACTTTTAATCTCCCAAGCTTCATGCGCCTTCTTGAAAAGCC
 
. : . : . : . : . : . :
JMSF038E04+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMSF011E13+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMFS014E04+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMSF040H17+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMSF030K01+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMFF033E09+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMSF016O01+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
JMFF006E01+ AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
                      ____________________________________________________________
consensus AAACATGTTGTTAACCCCCATATTTCACACAGCTAATATACTCTCAAACCTGAAACCTCA
 
. : . : . : . : . : . :
JMSF038E04+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCT
JMSF011E13+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGAC
JMFS014E04+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
JMSF040H17+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
JMSF030K01+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
JMFF033E09+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
JMSF016O01+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
JMFF006E01+ AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
                      ____________________________________________________________
consensus AAAGAACAATACAGTTAGCCAGTTAGGGTTTCACAGACATTGAAGAAGAAGAAGACCTAC
 
. : . : . : . : . : . :
JMFS014E04+ TGCCGACTAGCCGAGAGCTTCAACC
JMSF040H17+ TGCCGACTAGCCGAGAGCTTCAACCATCCATA
JMSF030K01+ TGCCGACTAGCCGAGAGCTTCAACCATCCATATCGACAATGACACACGCAATAGACTCCA
JMFF033E09+ TGCCGACTAGCCGAGAGCTTCAACCATCCATATCGACAATGACACACGCAATAGACTCCA
JMSF016O01+ TGCCGACTAGCCGAGAGCTTCAACCATCCATATCGACAATGAC
JMFF006E01+ TGCCGACTAGCCGAGAGCTTCAACCATCCATATCGACAATGACACACGCAATAGACTCCA
                      ____________________________________________________________
consensus TGCCGACTAGCCGAGAGCTTCAACCATCCATATCGACAATGACACACGCAATAGACTCCA
 
. : . : . : . : . : . :
JMSF030K01+ ACTTAGACTTTATTTTGGATTTTTTGTTGGCGCATATATACACACAGAATATTTGTATCT
JMFF033E09+ ACTTAGACTTTATTTTGGATTTTTTGTTGGCGCATATATACACACAGAATATTTGTATCT
JMFF006E01+ ACTTAGACTTTATTTTGGATTTTTTGTTGGCGCATATATACACACAGAATATTTGTATCT
                      ____________________________________________________________
consensus ACTTAGACTTTATTTTGGATTTTTTGTTGGCGCATATATACACACAGAATATTTGTATCT
 
. : . : . : . : . : . :
JMSF030K01+ ATATGTACTCCTGCATATACAC
JMFF033E09+ ATATGTACTCCTGCATATACACGAGGGAAGGATAGATGTGACTCTCTGTAAGTATAGGT
JMFF006E01+ ATATGTACTCCTGCATATACACGAGGGAAGGATAGATGTGACTCTCTGTAAGTATAGGTG
                      ____________________________________________________________
consensus ATATGTACTCCTGCATATACACGAGGGAAGGATAGATGTGACTCTCTGTAAGTATAGGTG
 
. : . : . : . : . : . :
JMFF006E01+ AGTTGTTGCGAGTGACTGAGCCGTGAAGGAGGGGCCGGGGGAGGGGGGTGTCAGAGTAAC
                      ____________________________________________________________
consensus AGTTGTTGCGAGTGACTGAGCCGTGAAGGAGGGGCCGGGGGAGGGGGGTGTCAGAGTAAC