Previous Contig 000302:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D09Sequence582000302 (2)gb:AB098630_15261206e-47Daucus carota DcCysP7 mRNA for cysteine protease, complete cds.748008419 (2)gb:SEN11_17149564e-46Hemerocallis hybrid cultivar cysteine proteinase (SEN11) mRNA, complete cds.
JMFF037A11Sequence573000302 (2)gb:AB098630_15261208e-47Daucus carota DcCysP7 mRNA for cysteine protease, complete cds.706008419 (2)gb:AB098625_15261164e-42Daucus carota DcCysP2 mRNA for cysteine protease, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF037A11+ GCAGTCGAGGAGTTGCTG
JMFF006D09+ TNTGCAGCCGTAGTTTTTAAGGTTGCAGTCGAGGAGTTGCTG
                      ____________________________________________________________
consensus TNTGCAGCCGTAGTTTTTAAGGTTGCAGTCGAGGAGTTGCTG
 
. : . : . : . : . : . :
JMFF037A11+ TTCGGATAAGCGCATTAGTTGGCCTGTTCTGATTTGGGTTATTCCTTCCATAGCCGCCAC
JMFF006D09+ TTCGGATAAGCGCATTAGTTGGCCTGTTCTGATTTGGGTTATTCCTTCCATAGCCGCCAC
                      ____________________________________________________________
consensus TTCGGATAAGCGCATTAGTTGGCCTGTTCTGATTTGGGTTATTCCTTCCATAGCCGCCAC
 
. : . : . : . : . : . :
JMFF037A11+ CGCAGAAAATGCCCAGCAACAACCGCAGTATCCTTGATTTTTTATATCAGTCACAGCACC
JMFF006D09+ CGCAGAAAATGCCCAGCAACAACCGCAGTATCCTTGATTTTTTATATCAGTCACAGCACC
                      ____________________________________________________________
consensus CGCAGAAAATGCCCAGCAACAACCGCAGTATCCTTGATTTTTTATATCAGTCACAGCACC
 
. : . : . : . : . : . :
JMFF037A11+ CTTCTCTCTCCAGTCCAAATACTCTGGAACTTCAGCCAAACTCTCATTCAGCAAGGATGC
JMFF006D09+ CTTCTCTCTCCAGTCCAAATACTNTGGAACTTCAGCCAAACTCTCATTCAGCAAGGATGC
                      ____________________________________________________________
consensus CTTCTCTCTCCAGTCCAAATACTCTGGAACTTCAGCCAAACTCTCATTCAGCAAGGATGC
 
. : . : . : . : . : . :
JMFF037A11+ TGGTTTTGAAGGCCTAGGGCGTGGGGGTGCCTTTCCTTCATTAAGCATGGTGGCCTTAAA
JMFF006D09+ TGGTTTTGAAGGCCTAGGGCGTGGGGGTGCCTTTCCTTCATTAAGCATGGTGGCCTTAAA
                      ____________________________________________________________
consensus TGGTTTTGAAGGCCTAGGGCGTGGGGGTGCCTTTCCTTCATTAAGCATGGTGGCCTTAAA
 
. : . : . : . : . : . :
JMFF037A11+ CTCTTCGTTAGTTAAATCGCTAAACTTTTTGACACCAAGTTTATAAGATTGATTGCCAGC
JMFF006D09+ CTCTTCGTTAGTTAAATCGCTAAACTTTTTGACACCAAGTTTATAAGATTGATTGCCAGC
                      ____________________________________________________________
consensus CTCTTCGTTAGTTAAATCGCTAAACTTTTTGACACCAAGTTTATAAGATTGATTGCCAGC
 
. : . : . : . : . : . :
JMFF037A11+ TTTGTTAAATGACTCAATGAACTTCACGTTTTGCTCAAATATCTTGAATCGTTTTGCCTT
JMFF006D09+ TTTGTTAAATGACTCAATGAACTTCACGTTTTGCTCAAATATCTTGAATCGTTTTGCCTT
                      ____________________________________________________________
consensus TTTGTTAAATGACTCAATGAACTTCACGTTTTGCTCAAATATCTTGAATCGTTTTGCCTT
 
. : . : . : . : . : . :
JMFF037A11+ TTCTGCATCATTTTTGTATGAGCGCCCATGGTGAACCATCCACTTTTCATGGCGCTCGAG
JMFF006D09+ TTCTGCATCATTTTTGTATGAGCGCCCATGGTGAACCATCCACTTTTCATGGCGCTCGAG
                      ____________________________________________________________
consensus TTCTGCATCATTTTTGTATGAGCGCCCATGGTGAACCATCCACTTTTCATGGCGCTCGAG
 
. : . : . : . : . : . :
JMFF037A11+ CATAGAAGGTTCTTCGTCGAGGGCAGTGGCTTGAGATGCAAACGCCCCCAACAGGAGAAC
JMFF006D09+ CATAGAAGGTTCTTCGTCGAGGGCAGTGGCTTGAGATGCAAACGCCCCCAACAGGAGAAC
                      ____________________________________________________________
consensus CATAGAAGGTTCTTCGTCGAGGGCAGTGGCTTGAGATGCAAACGCCCCCAACAGGAGAAC
 
. : . : . : . : . : . :
JMFF037A11+ TGCTGCAAGAATCAATTGGAAATCAAAGTTGGAGGCCATGGAAGATAGTATGTTTGTGGT
JMFF006D09+ TGCTGCAAGAATCAATTGGAAATCAAAGTTGGAGGCCATGGAAGATAGTATGTTTGTGGT
                      ____________________________________________________________
consensus TGCTGCAAGAATCAATTGGAAATCAAAGTTGGAGGCCATGGAAGATAGTATGTTTGTGGT