Previous Contig 000298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B13Sequence501000298 (7)gb:AY052664_15628248e-20Arabidopsis thaliana T23O15.3/T23O15.3 mRNA, complete cds.764010898 (7)gb:AC124141_17404002e-82Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMFF013M16Sequence548000298 (7)gb:AY052664_15628248e-27Arabidopsis thaliana T23O15.3/T23O15.3 mRNA, complete cds.776010898 (7)gb:AC124141_17404003e-89Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMFF015D10Sequence556000298 (7)gb:AY052664_15628244e-29Arabidopsis thaliana T23O15.3/T23O15.3 mRNA, complete cds.710010898 (7)gb:AC124141_17404002e-69Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMFF035H09Sequence575000298 (7)gb:AY052664_15628245e-30Arabidopsis thaliana T23O15.3/T23O15.3 mRNA, complete cds.725010898 (7)gb:AC124141_17404003e-78Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMFF049F08Sequence642000298 (7)gb:AY052664_15628246e-37Arabidopsis thaliana T23O15.3/T23O15.3 mRNA, complete cds.594010898 (7)gb:AC124141_17404006e-40Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMFS055A01Sequence542000298 (7)gb:AC124141_17404004e-23Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet
JMSF007A20Sequence317000298 (7)777010898 (7)gb:AC124141_17404001e-78Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0065C11, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS055A01+ GAAAGA
                      ____________________________________________________________
consensus GAAAGA
 
. : . : . : . : . : . :
JMFS055A01+ TAGATAGATATGATGATGGCAATCTGCAGCACAGCGGTTGCATTCATTTTTATTATCGTA
                      ____________________________________________________________
consensus TAGATAGATATGATGATGGCAATCTGCAGCACAGCGGTTGCATTCATTTTTATTATCGTA
 
. : . : . : . : . : . :
JMFS055A01+ CTTAGCTTGGGTTGTTATATGATTCTGAAATTGAGGTGCCGGTCCTCCGATGATAAGGTT
                      ____________________________________________________________
consensus CTTAGCTTGGGTTGTTATATGATTCTGAAATTGAGGTGCCGGTCCTCCGATGATAAGGTT
 
. : . : . : . : . : . :
JMFS055A01+ GTTCCTAGGAACTGGCCACTAGTTGGAATGATGCCGGCGCTTCTTAAGAATGCTCACCGA
                      ____________________________________________________________
consensus GTTCCTAGGAACTGGCCACTAGTTGGAATGATGCCGGCGCTTCTTAAGAATGCTCACCGA
 
. : . : . : . : . : . :
JMFS055A01+ GTCCACGAATTCGCGACTGATGTTCTGAAACACAGCGGAGGGACATTTGAGTTTAAAGGT
                      ____________________________________________________________
consensus GTCCACGAATTCGCGACTGATGTTCTGAAACACAGCGGAGGGACATTTGAGTTTAAAGGT
 
. : . : . : . : . : . :
JMFS055A01+ CCAGCTGCCTTTGCTAACTTGAGCATGCTGGCTACCAGCGACCCTGCTAACATCCACCAT
                      ____________________________________________________________
consensus CCAGCTGCCTTTGCTAACTTGAGCATGCTGGCTACCAGCGACCCTGCTAACATCCACCAT
 
. : . : . : . : . : . :
JMFS055A01+ ATCCTCAGCAAAAACTTCTCCAACTATCCCAAGTGAAGCTTCTCAAACTTCCTTCCATCA
JMFF015D10+ AAGCTTCTCAAACTTCCTTCCATCA
JMFF013M16+ CTTCCTTCCATCA
JMFF035H09+ AAGCTTCTCAAACTTCCTTCCATCA
JMFF049F08+ CAAGTGAAGCTTCTCAAACTTCCTTCCATCA
                      ____________________________________________________________
consensus ATCCTCAGCAAAAACTTCTCCAACTATCCCAAGTGAAGCTTCTCAAACTTCCTTCCATCA
 
. : . : . : . : . : . :
JMFS055A01+ CTTCCTGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
JMFF015D10+ CTTCCTGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
JMFF013M16+ CTTCCTGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
JMFF035H09+ CTTCCTGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
JMFF049F08+ CTTCCAGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
JMFF006B13+ CCAAGGAAACGTTCCCGCGAA
                      ____________________________________________________________
consensus CTTCCTGCTACAAATTCCCTACCTATTACTTTTCTTGTTCCAAGGAAACGTTCCCGCGAA
 
. : . : . : . : . : . :
JMFS055A01+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
JMFF015D10+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
JMFF013M16+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
JMFF035H09+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
JMFF049F08+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
JMFF006B13+ TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
                      ____________________________________________________________
consensus TGCTTTTTGCTGGACTGCTCAAATAGAGCTGCCACAGTAGTGGCACCTTCCCAGGGAACA
 
. : . : . : . : . : . :
JMFS055A01+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAAC
JMFF015D10+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
JMFF013M16+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
JMFF035H09+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
JMFF049F08+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
JMFF006B13+ TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
                      ____________________________________________________________
consensus TCCACCAATTGGGTATACTTAGCATTACGCATTGCAAAACCTGCCTCACCACCAACTTCT
 
. : . : . : . : . : . :
JMFF015D10+ ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
JMFF013M16+ ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
JMFF035H09+ ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
JMFF049F08+ ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
JMSF007A20+ GCCATGGAAAGTATGATG
JMFF006B13+ ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
                      ____________________________________________________________
consensus ACTGGAACCCCTCTCTTTCTTGACTTCTTCTTCCCTGAGAGGGCCATGGAAAGTATGATG
 
. : . : . : . : . : . :
JMFF015D10+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
JMFF013M16+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
JMFF035H09+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
JMFF049F08+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
JMSF007A20+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
JMFF006B13+ GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
                      ____________________________________________________________
consensus GGTATACTAATAGCAGCAATAACTGCAAATAGTTTAACATTATTATCAGTTGTCCCCAAA
 
. : . : . : . : . : . :
JMFF015D10+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
JMFF013M16+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
JMFF035H09+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
JMFF049F08+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
JMSF007A20+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
JMFF006B13+ ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
                      ____________________________________________________________
consensus ATAGTTGTATTTGGGGTACTTCCTTCAGGCCCTTCCATTTTGCAATCTATATGCTTCTCC
 
. : . : . : . : . : . :
JMFF015D10+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
JMFF013M16+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
JMFF035H09+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
JMFF049F08+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
JMSF007A20+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
JMFF006B13+ TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
                      ____________________________________________________________
consensus TTTTACAGAATGAGCAACTAAAGGGCAGCAAACAAAACGAACGCCGTGATCGTCAAGCTT
 
. : . : . : . : . : . :
JMFF015D10+ CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
JMFF013M16+ CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
JMFF035H09+ CCGAAATCCGCAACAACTCTAGCGGCT
JMFF049F08+ CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
JMSF007A20+ CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
JMFF006B13+ CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
                      ____________________________________________________________
consensus CCGAAATCCGCAACAACTCTAGCGGCTCTTCGAGAGTACGGCTAACGGTCTAGAGCTGCA
 
. : . : . : . : . : . :
JMFF015D10+ TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTC
JMFF013M16+ TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTCTTCT
JMFF049F08+ TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTCTTCT
JMSF007A20+ TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTCTTCT
JMFF006B13+ TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTCTTCTGTGTT
                      ____________________________________________________________
consensus TTCCTGCGATAGGAAAAGTCGAGAAAGAAATCTTTCCAGAATAAGATGCTCTTCTGTGTT