Previous Contig 000295:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B02Sequence498000295 (7)pir|T48328|T483285e-32importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF018E15Sequence522000295 (7)pir|T48328|T483281e-35importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops763009054 (3)pir|T48328|T483288e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF026O14Sequence521000295 (7)pir|T48328|T483286e-36importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops768009054 (3)pir|T48328|T483288e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF031H04Sequence603000295 (7)pir|T48328|T483288e-37importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops716009054 (3)pir|T48328|T483287e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF031M19Sequence459000295 (7)pir|T48328|T483287e-26importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF043P11Sequence631000295 (7)pir|T48328|T483282e-38importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops651010378 (12)gb:AY286010_15947827e-16Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF046H23Sequence568000295 (7)pir|T48328|T483287e-32importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043P11+ CCAAGCCGCTTCAAGCAACTGTTCATCTGGA
JMFF031H04+ GGA
                      ____________________________________________________________
consensus CCAAGCCGCTTCAAGCAACTGTTCATCTGGA
 
. : . : . : . : . : . :
JMFF046H23+ GCAGAGCTCCAGCCTCGAGGGCAGCTTCA
JMFF043P11+ GACCCAAATGAAAGACATTTCACAAGGAGAGGCAGAGCTCCAGCCTCGAGGGCAGCTTCA
JMFF031H04+ GACCCAAATGAAAGACATTTCACAAGGAGAGGCAGAGCTCCAGCNTCGAGGGCAGCTTCA
                      ____________________________________________________________
consensus GACCCAAATGAAAGACATTTCACAAGGAGAGGCAGAGCTCCAGCCTCGAGGGCAGCTTCA
 
. : . : . : . : . : . :
JMFF046H23+ ACAGGA-GGAATTCTGACCTAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTT
JMFF043P11+ ACAGGAGGGAATTCTGACCTAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTN
JMFF031H04+ ACAGGAGGGAATTCTGACCTAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTT
JMFF026O14+ TAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTT
JMFF018E15+ CTAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTT
JMFF006B02+ CGGAGAGCATTCACTCTT
                      ____________________________________________________________
consensus ACAGGAGGGAATTCTGACCTAGAAAGCAGACGTCTTAGCTCACGGAGAGCATTCACTCTT
 
. : . : . : . : . : . :
JMFF046H23+ TCCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF043P11+ TTCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF031H04+ TTCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF026O14+ TTCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF031M19+ TGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF018E15+ TCCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
JMFF006B02+ TTCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
                      ____________________________________________________________
consensus TTCTGTACAGCACCTTTCCCCTGATGGGCAACAGCAAGTTTTAATTCTTCCACAGCTGAT
 
. : . : . : . : . : . :
JMFF046H23+ GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF043P11+ GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF031H04+ GAAGTCTGAAACTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF026O14+ GAAGTCTGAAACTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF031M19+ GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF018E15+ GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
JMFF006B02+ GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
                      ____________________________________________________________
consensus GAAGTCTGAACCTCCAAAATAGATTGCTCTTCGTCAATCATCATATCAGCTTCAGGAGCA
 
. : . : . : . : . : . :
JMFF046H23+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF043P11+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF031H04+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF026O14+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF031M19+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF018E15+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
JMFF006B02+ ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
                      ____________________________________________________________
consensus ACATCAGAATCACCAGTAATCCCCACCCTGCAAAGGCGCTTTGTTCTCATCAGCGTTTCT
 
. : . : . : . : . : . :
JMFF046H23+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF043P11+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF031H04+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF026O14+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF031M19+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF018E15+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
JMFF006B02+ CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
                      ____________________________________________________________
consensus CTTCTTTCTTTCCCCACTGTAACTGCATTCTCCCGTCTTCTTTGTGCTGCAGTATTCCCA
 
. : . : . : . : . : . :
JMFF046H23+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF043P11+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF031H04+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF026O14+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF031M19+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF018E15+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
JMFF006B02+ ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
                      ____________________________________________________________
consensus ACTGATGACTTTATGGGGTCTCTTTTATGAGAAGCCGCGCCTTCATCCGCCATTACTGCT
 
. : . : . : . : . : . :
JMFF046H23+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF043P11+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF031H04+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF026O14+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF031M19+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF018E15+ GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
JMFF006B02+ GAAGTAAGCTCCAAGANTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
                      ____________________________________________________________
consensus GAAGTAAGCTCCAAGACTAAGTTCTCCACTTGGATTTCCGGTGAATAGCAGATAATAAAA
 
. : . : . : . : . : . :
JMFF046H23+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF043P11+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF031H04+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF026O14+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF031M19+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF018E15+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
JMFF006B02+ TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
                      ____________________________________________________________
consensus TTAAAGCATTGAGCTTTTAGCTGCTGGGATTTATGGGATTTTGGTTTTTTGTGCTGTTCA
 
. : . : . : . : . : . :
JMFF046H23+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF043P11+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF031H04+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF026O14+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF031M19+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF018E15+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
JMFF006B02+ ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT
                      ____________________________________________________________
consensus ACACCACTCAGTGTGATATGATTGTTCCCCTTTCTCGGCGCTCGCCCGAGAACCGAAAAT