Previous Contig 000289:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005O16Sequence481000289 (23)gb:CAV417975_16456195e-36Corylus avellana lox gene for lipoxygenase, exons 1-9.750009899 (3)pir|T07775|T077754e-89lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF030M17Sequence396000289 (23)pir|S57964|S579643e-21lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro481009899 (3)pir|T07775|T077751e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS009E08Sequence602000289 (23)pir|S57964|S579644e-59lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS027A03Sequence574000289 (23)pir|S57964|S579641e-56lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS043A12Sequence468000289 (23)gb:CAV417975_16456193e-20Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS046B09Sequence597000289 (23)pir|S57964|S579645e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS047E04Sequence617000289 (23)pir|S57964|S579645e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS050H03Sequence400000289 (23)pir|S57964|S579645e-30lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS063D04Sequence608000289 (23)gb:CAV417975_16456192e-63Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS063D07Sequence611000289 (23)gb:CAV417975_16456196e-64Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS065H07Sequence627000289 (23)gb:CAV417975_16456192e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS089G10Sequence628000289 (23)pir|S57964|S579644e-56lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS090B08Sequence632000289 (23)gb:CAV417975_16456192e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS093F02Sequence624000289 (23)gb:CAV417975_16456193e-56Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS097D04Sequence612000289 (23)gb:CAV417975_16456192e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS098G09Sequence627000289 (23)pir|S57964|S579645e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS100E05Sequence612000289 (23)gb:CAV417975_16456192e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS109C03Sequence612000289 (23)gb:CAV417975_16456192e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS118E06Sequence410000289 (23)pir|S57964|S579643e-30lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS119B11Sequence627000289 (23)gb:CAV417975_16456196e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS148E04Sequence617000289 (23)pir|S57964|S579645e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS161A06Sequence612000289 (23)pir|S57964|S579646e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS161D12Sequence612000289 (23)pir|S57964|S579642e-60lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS063D07+ CTCTC
                      ____________________________________________________________
consensus CTCTC
 
. : . : . : . : . : . :
JMFS063D07+ AAGTTCTTCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS063D04+ GTTCTTCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS119B11+ CTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS161A06+ TTCCCTGTACGGAAGGAGCGGCGCCGGCGTCTGGCTGGGNAGG
JMFS065H07+ CAGCTCCGCTTCCCTGTACGGAAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS148E04+ TCCCTGTACGGAAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS047E04+ TCCCTGTACGGAAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS093F02+ CGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS109C03+ TCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS097D04+ TCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS100E05+ TCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS161D12+ TCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS046B09+ TCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS090B08+ TCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS089G10+ TCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
JMFS098G09+ CCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGNAGG
JMFS027A03+ G
JMFS009E08+ CGTCTGGCTGGGNAGG
                      ____________________________________________________________
consensus AAGTTCTTCAGCTCCGCTTCCCTGTACGGGAGGAGCGGCGCCGGCGTCTGGCTGGGGAGG
 
. : . : . : . : . : . :
JMFS063D07+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS063D04+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS119B11+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS161A06+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS065H07+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS148E04+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS047E04+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS093F02+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATANAACCCA
JMFS109C03+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS097D04+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS100E05+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS161D12+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS046B09+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS090B08+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS089G10+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS098G09+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS027A03+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
JMFS009E08+ TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
                      ____________________________________________________________
consensus TAGGCCTGGTTGGTGAAGAAAATGCGTTCGTAGTTGTAGTTCCCGGCGGGATA-AACCCA
 
. : . : . : . : . : . :
JMFS063D07+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS063D04+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS119B11+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS161A06+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS065H07+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS148E04+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS047E04+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS093F02+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS109C03+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS097D04+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS100E05+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS161D12+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS046B09+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS090B08+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS089G10+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS098G09+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS027A03+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFS043A12+ AGGGTCTN
JMFS009E08+ GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
JMFF005O16+ TCTT
                      ____________________________________________________________
consensus GGAAAAGCAGACGAACTGGACGGGGCCGTGATTGGGGACGTCTTCCAGGGTGAGGGTCTT
 
. : . : . : . : . : . :
JMFS063D07+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS063D04+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS119B11+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS161A06+ GAGATAGAACTCGATGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS065H07+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS148E04+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS047E04+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS093F02+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS109C03+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS097D04+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS100E05+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS161D12+ GAGATAGAACTCGATGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS046B09+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS090B08+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS089G10+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACACCGATGC
JMFS098G09+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS027A03+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS043A12+ GAGATAGAACTCTCTGTGGTGTTTGTTTTTGATCACATTCGCCCC-GGGAACGCCGATGC
JMFS009E08+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
JMFS118E06+ GGAACGCCGATGC
JMFS050H03+ ATGC
JMFF005O16+ GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCCGGGGAACGCCGATGC
                      ____________________________________________________________
consensus GAGATAGAACTCGCTGTGGTGATTGTTGTTGATCACAAACGCCCC-GGGAACGCCGATGC
 
. : . : . : . : . : . :
JMFS063D07+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS063D04+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS119B11+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS161A06+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS065H07+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS148E04+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS047E04+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS093F02+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS109C03+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS097D04+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS100E05+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS161D12+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS046B09+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS090B08+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS089G10+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS098G09+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS027A03+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS043A12+ TTTCGTCCCATTCGAATGTTACCTCGTACGCGCTTCGTCCCGCCGTCAACGGCGTCGGTT
JMFS009E08+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS118E06+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFS050H03+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTATCGGCGTCGGTT
JMFF030M17+ CTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
JMFF005O16+ TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
                      ____________________________________________________________
consensus TCTCGTCCCATTCGAATGTTACCTCGTACGCGCTTTCGCCCGCCGCTAACGGCGTCGGTT
 
. : . : . : . : . : . :
JMFS063D07+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS063D04+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS119B11+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS161A06+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS065H07+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS148E04+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS047E04+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS093F02+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS109C03+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS097D04+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS100E05+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS161D12+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS046B09+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS090B08+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS089G10+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS098G09+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS027A03+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS043A12+ TGCTCCAGTTTTTAAGGTACTTATCCTTGCTCCGTTTCTCTTGTTATCCTTTT-TCAGTA
JMFS009E08+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS118E06+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFS050H03+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
JMFF030M17+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTTNTCAGGA
JMFF005O16+ TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
                      ____________________________________________________________
consensus TGCTCCAGTTTTCAAGGTACGAAACCTTGCCCCGTTTCCCTTGTAAACCTTTT-TCAGGA
 
. : . : . : . : . : . :
JMFS063D07+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS063D04+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS119B11+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS161A06+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS065H07+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS148E04+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS047E04+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS093F02+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS109C03+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS097D04+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS100E05+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS161D12+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS046B09+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS090B08+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS089G10+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS098G09+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS027A03+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS043A12+ TCAGTATTTTCTTGCTTTTATTAGTTCAAAGGAGACCTTCTGGCCTACCAATTCATGGAC
JMFS009E08+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS118E06+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFS050H03+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACTTTNGGNCCGACCAATTCATGGAC
JMFF030M17+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
JMFF005O16+ TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
                      ____________________________________________________________
consensus TCAGCATTTAC-GGCACTGATGAGTTCAAAGGAGACCTTCTGGCCGACCAATTCATGGAC
 
. : . : . : . : . : . :
JMFS063D07+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS063D04+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS119B11+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS161A06+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS065H07+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS148E04+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS047E04+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS093F02+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS109C03+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS097D04+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS100E05+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS161D12+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS046B09+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS090B08+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS089G10+ AGTGTCGATGAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS098G09+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS027A03+ AGTGTCGA-GAACGGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS043A12+ AGTGTCGA-TAACAGAAGCACCAATGTCCTTCAGGNCCAAAGCATTCTTCTTCANCAACA
JMFS009E08+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS118E06+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFS050H03+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFF030M17+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
JMFF005O16+ AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
                      ____________________________________________________________
consensus AGTGTCGA-GAACAGAAGCACCAATGTCCTTCAGGTCCAAAGCATTCTTCTTCATCAACA
 
. : . : . : . : . : . :
JMFS063D07+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS063D04+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS119B11+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS161A06+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS065H07+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS148E04+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS047E04+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS093F02+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS109C03+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS097D04+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS100E05+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS161D12+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS046B09+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS090B08+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS089G10+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS098G09+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS027A03+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS043A12+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCNCGGCGGCGGNGTCATGTTTTCCGGTGA
JMFS009E08+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS118E06+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFS050H03+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFF030M17+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
JMFF005O16+ CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
                      ____________________________________________________________
consensus CCACCGTTCCTTTGATGATCTTCGGCTTCTCCTCGGCGGCGGCGTCATGTTTTCCGGTGA
 
. : . : . : . : . : . :
JMFS063D07+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS063D04+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS119B11+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS161A06+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS065H07+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS148E04+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS047E04+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS093F02+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS109C03+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS097D04+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS100E05+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS161D12+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS046B09+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS090B08+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS089G10+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS098G09+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS027A03+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS043A12+ TGGCACCCACAATCNTGCCCAGAATCATCCTAAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS009E08+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS118E06+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFS050H03+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
JMFF030M17+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAANCAACTTAGTATA
JMFF005O16+ TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
                      ____________________________________________________________
consensus TGGCACCCACAATCTTGCCCAGAATCATCCTTAGTTTTCTCGAAAAAACAACTTAGTATA
 
. : . : . : . : . : . :
JMFS063D07+ TATATGTTCGT
JMFS063D04+ TATATGTTCGT
JMFS119B11+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAG
JMFS161A06+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGA
JMFS065H07+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGA
JMFS148E04+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGA
JMFS047E04+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGA
JMFS093F02+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGA
JMFS109C03+ TATATGTTCGTGTATGTTAATGAA
JMFS097D04+ TATATGTTCGTGTATGTTAATGAA
JMFS100E05+ TATATGTTCGTGTATGTTAATGAA
JMFS161D12+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAG
JMFS046B09+ TATATGTTCGTGTATGTTAA
JMFS090B08+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGA
JMFS089G10+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGA
JMFS098G09+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGAGAAGTGG
JMFS027A03+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAA
JMFS043A12+ TATATGGTCGNGTATGNTAATGAAGAGATAGAGAGAAAGAGAG
JMFS009E08+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGAGAAGTGG
JMFS118E06+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGA
JMFS050H03+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAG
JMFF030M17+ TATANGTTCGNGTATGTTAATGAAGAGATAGAGAGAAAGAGAGAGAAGTGGGTTTGTGAT
JMFF005O16+ TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGAGAAGTGGGTTTGTGAT
                      ____________________________________________________________
consensus TATATGTTCGTGTATGTTAATGAAGAGATAGAGAGAAAGAGAGAGAAGTGGGTTTGTGAT