Previous Contig 000281:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005L11Sequence551000281 (16)pir|S57964|S579642e-52lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro794010340 (7)pir|S57964|S57964e-103lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF011D02Sequence438000281 (16)pir|S57964|S579643e-32lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro699010340 (7)pir|S57964|S579641e-86lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF016K15Sequence589000281 (16)pir|S57964|S579642e-58lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro768010340 (7)pir|S57964|S579641e-89lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF021G17Sequence546000281 (16)pir|S57964|S579645e-51lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro696010340 (7)pir|S57964|S579641e-88lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF021L14Sequence606000281 (16)pir|S57964|S579646e-61lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro679010340 (7)pir|S57964|S579642e-83lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF028H22Sequence459000281 (16)pir|S57964|S579643e-36lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFF043L01Sequence644000281 (16)pir|S57964|S579648e-65lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro635010340 (7)pir|S57964|S579641e-63lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS030G09Sequence508000281 (16)pir|S57964|S579644e-50lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS041B05Sequence610000281 (16)pir|T07775|T077752e-70lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS051C07Sequence584000281 (16)pir|S57964|S579642e-66lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS054B12Sequence627000281 (16)pir|S57964|S579645e-65lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS078B06Sequence626000281 (16)pir|S57964|S579642e-66lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS096C07Sequence610000281 (16)pir|S57964|S579643e-63lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS141E02Sequence623000281 (16)pir|S57964|S579642e-66lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS145A11Sequence614000281 (16)pir|S57964|S579643e-89lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS166H01Sequence621000281 (16)gb:AY498566_16093867e-32Capsicum annuum lipoxygenase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS145A11+ AAGGAAAGGGCACTATAAGGAAATGGACTAAAGCTTACCTT
                      ____________________________________________________________
consensus AAGGAAAGGGCACTATAAGGAAATGGACTAAAGCTTACCTT
 
. : . : . : . : . : . :
JMFS145A11+ GGATAACCTGTGGGGTAGGGAATTTAAAGAGTCCCTCCCCATCACTTCGGATAAGTTCTT
                      ____________________________________________________________
consensus GGATAACCTGTGGGGTAGGGAATTTAAAGAGTCCCTCCCCATCACTTCGGATAAGTTCTT
 
. : . : . : . : . : . :
JMFS145A11+ TAAGCATCTCAAGGGGAATGTTATCTGCGATGGCCGTAAGCAAAGGCCCTTGCGGCAGCT
                      ____________________________________________________________
consensus TAAGCATCTCAAGGGGAATGTTATCTGCGATGGCCGTAAGCAAAGGCCCTTGCGGCAGCT
 
. : . : . : . : . : . :
JMFS145A11+ TGATCCCTCCTTCATAGAGATTAAGTATATCTTGAAAGCTGTCAAACTCAGTCGGGGTGG
                      ____________________________________________________________
consensus TGATCCCTCCTTCATAGAGATTAAGTATATCTTGAAAGCTGTCAAACTCAGTCGGGGTGG
 
. : . : . : . : . : . :
JMFS145A11+ AATCAAACAGAGACTCAAATTCAGGGAGAAGGAACTGAGCAACAGATTTCAATGCATAAG
                      ____________________________________________________________
consensus AATCAAACAGAGACTCAAATTCAGGGAGAAGGAACTGAGCAACAGATTTCAATGCATAAG
 
. : . : . : . : . : . :
JMFS145A11+ TAAGAAAGTCTGCCAATTTCAGGTGTCCAAATTTCTCGTCCCTCGGAACATAAATGTCCA
                      ____________________________________________________________
consensus TAAGAAAGTCTGCCAATTTCAGGTGTCCAAATTTCTCGTCCCTCGGAACATAAATGTCCA
 
. : . : . : . : . : . :
JMFS145A11+ AGCTTGTAAGCAGTGGAATTCTGCTCTCAGAATTAGGATCAGTTTTTGTTGGTGCTCTGC
                      ____________________________________________________________
consensus AGCTTGTAAGCAGTGGAATTCTGCTCTCAGAATTAGGATCAGTTTTTGTTGGTGCTCTGC
 
. : . : . : . : . : . :
JMFS145A11+ CAGTCCTTCCTCGTCGAGGATAAGGATACTCTGAGTTTCCACCCAAGATTGGCCGGGCAT
                      ____________________________________________________________
consensus CAGTCCTTCCTCGTCGAGGATAAGGATACTCTGAGTTTCCACCCAAGATTGGCCGGGCAT
 
. : . : . : . : . : . :
JMFS145A11+ ATTCTGCACCTTTGTCTGGATCACCCAAGTCATTGTAGTAGGCATAGTCATACACCCTGT
JMFS041B05+ GGCATAGTCATACACCCTGT
                      ____________________________________________________________
consensus ATTCTGCACCTTTGTCTGGATCACCCAAGTCATTGTAGTAGGCATAGTCATACACCCTGT
 
. : . : . : . : . : . :
JMFS145A11+ CCCATTCCTTAAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS041B05+ CCCATTCC-TAAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS141E02+ AAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS051C07+ AAGCTCGCCAGTTCCTGTCCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS078B06+ AAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS096C07+ CTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS166H01+ AGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFS054B12+ CCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
JMFF021L14+ ATCTCGAT
JMFF043L01+ CGCCAGTTCCTGTCCCTCTCAAGTGCACTAATTCTTCATCTCGAT
                      ____________________________________________________________
consensus CCCATTCCTTAAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
 
. : . : . : . : . : . :
JMFS145A11+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAA
JMFS041B05+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFS141E02+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFS051C07+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFS078B06+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFS096C07+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFS166H01+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGG-TTGAAAAGAAGATGC
JMFS054B12+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFF021L14+ ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFF016K15+ ACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
JMFF043L01+ ATTTCTTCAACGGGGCAGGTGTTTGGCTGGANAGATATGCCTGGTTTGAAAAGAAGATGC
JMFF021G17+ AAGATGC
JMFF005L11+ AAAAGAAGATGC
                      ____________________________________________________________
consensus ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
 
. : . : . : . : . : . :
JMFS041B05+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS141E02+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS051C07+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS078B06+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS096C07+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS166H01+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS054B12+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFF021L14+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFF016K15+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFF043L01+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFF021G17+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFS030G09+ TAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
JMFF005L11+ GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
                      ____________________________________________________________
consensus GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
 
. : . : . : . : . : . :
JMFS041B05+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS141E02+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS051C07+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS078B06+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS096C07+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS166H01+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS054B12+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF021L14+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF016K15+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF043L01+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF021G17+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFS030G09+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF028H22+ AAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
JMFF011D02+ AACTCATTGGGATGATTGT
JMFF005L11+ CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
                      ____________________________________________________________
consensus CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
 
. : . : . : . : . : . :
JMFS041B05+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS141E02+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS051C07+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS078B06+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS096C07+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS166H01+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAATTTTTG
JMFS054B12+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF021L14+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF016K15+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF043L01+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF021G17+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFS030G09+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF028H22+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTNGAACTCAA-TTTTG
JMFF011D02+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
JMFF005L11+ TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
                      ____________________________________________________________
consensus TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAA-TTTTG
 
. : . : . : . : . : . :
JMFS041B05+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS141E02+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS051C07+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS078B06+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS096C07+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS166H01+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS054B12+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF021L14+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF016K15+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF043L01+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF021G17+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFS030G09+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF028H22+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF011D02+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
JMFF005L11+ AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
                      ____________________________________________________________
consensus AACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCT
 
. : . : . : . : . : . :
JMFS041B05+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS141E02+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS051C07+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS078B06+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS096C07+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS166H01+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS054B12+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF021L14+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF016K15+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF043L01+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF021G17+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFS030G09+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF028H22+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF011D02+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
JMFF005L11+ GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
                      ____________________________________________________________
consensus GCCTTGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGC
 
. : . : . : . : . : . :
JMFS041B05+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS141E02+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS051C07+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATATAGGCATTGAAG
JMFS078B06+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS096C07+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS166H01+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS054B12+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF021L14+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF016K15+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF043L01+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF021G17+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFS030G09+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF028H22+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF011D02+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
JMFF005L11+ TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
                      ____________________________________________________________
consensus TCTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAG
 
. : . : . : . : . : . :
JMFS041B05+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS141E02+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS051C07+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS078B06+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS096C07+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS166H01+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS054B12+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF021L14+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF016K15+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF043L01+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF021G17+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFS030G09+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF028H22+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
JMFF011D02+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATNTTCTTCGTC
JMFF005L11+ TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
                      ____________________________________________________________
consensus TCATTGAAGTCCAGGACGTTCTTCCTCATCAGCACCACTTTCCCCTTTATCTTCTTCGTC
 
. : . : . : . : . : . :
JMFS041B05+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATC
JMFS141E02+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFS051C07+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCT
JMFS078B06+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFS096C07+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFS166H01+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFS054B12+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF021L14+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF016K15+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF043L01+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF021G17+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFS030G09+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF028H22+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATNTTCACCAAATCTTGTTTCTTTAAT
JMFF011D02+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
JMFF005L11+ GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
                      ____________________________________________________________
consensus GGCGACAGCGCCTCCGCCAGCTTTCCCAGCAACATCTTCACCAAATCTTGTTTCTTTAAT
 
. : . : . : . : . : . :
JMFS141E02+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGA
JMFS078B06+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGA
JMFS096C07+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAAT
JMFS166H01+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAAT
JMFS054B12+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATT
JMFF021L14+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGT
JMFF016K15+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGT
JMFF043L01+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGT
JMFF021G17+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGT
JMFS030G09+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGA
JMFF028H22+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGT
JMFF011D02+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGT
JMFF005L11+ TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGTC
                      ____________________________________________________________
consensus TTTCAGAGATCAGATAGATAGATAGAGAGAGAGAGAGGAATTATTGTTTGTGTTGTTGTC