Previous Contig 000278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A12Sequence546000278 (24)sp|Q03684|BIP4_TOBAC5e-66Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho765010344 (23)sp|Q03685|BIP5_TOBAC4e-43Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMFF004M11Sequence574000278 (24)sp|Q03684|BIP4_TOBAC4e-72Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho
JMFF005K09Sequence455000278 (24)sp|Q03684|BIP4_TOBAC5e-48Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho690010344 (23)pir|PQ0262|S218789e-49dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF010M12Sequence503000278 (24)sp|Q03684|BIP4_TOBAC2e-58Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho684010344 (23)pir|PQ0262|S218782e-41dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF023G05Sequence499000278 (24)sp|Q03684|BIP4_TOBAC2e-56Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho664010344 (23)pir|PQ0262|S218782e-26dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF027L08Sequence549000278 (24)sp|Q03684|BIP4_TOBAC4e-68Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho691010344 (23)pir|PQ0262|S218782e-41dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF030E07Sequence497000278 (24)sp|Q03684|BIP4_TOBAC1e-55Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho620010344 (23)pir|PQ0262|S218782e-35dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF030F21Sequence130000278 (24)684010344 (23)pir|PQ0262|S218782e-40dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF034L08Sequence553000278 (24)sp|Q03684|BIP4_TOBAC4e-68Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho680010344 (23)pir|PQ0262|S218785e-41dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF035J20Sequence524000278 (24)sp|Q03684|BIP4_TOBAC3e-72Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho
JMFF043L08Sequence636000278 (24)sp|Q03684|BIP4_TOBAC5e-83Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho612010344 (23)pir|PQ0262|S218784e-29dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF047N14Sequence633000278 (24)sp|Q03684|BIP4_TOBAC2e-82Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho604010344 (23)pir|PQ0262|S218781e-29dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFS153D02Sequence614000278 (24)sp|Q03684|BIP4_TOBAC1e-83Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho
JMSF008A07Sequence198000278 (24)sp|Q03684|BIP4_TOBAC6e-04Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho769010344 (23)sp|Q03685|BIP5_TOBAC2e-57Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF011D11Sequence252000278 (24)sp|Q03684|BIP4_TOBAC4e-12Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho788010344 (23)gb:PAB132533_16986132e-47Picea abies mRNA for 78 kDa glucose regulated protein homolog 4 precursor, parti
JMSF011J20Sequence295000278 (24)sp|Q03684|BIP4_TOBAC7e-20Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho773010344 (23)sp|Q03685|BIP5_TOBAC2e-57Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF012A24Sequence202000278 (24)sp|Q03684|BIP4_TOBAC6e-04Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho732010344 (23)sp|Q03685|BIP5_TOBAC8e-76Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF024L24Sequence706000278 (24)sp|Q03684|BIP4_TOBACe-118Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho452010344 (23)gb:AY389685_11783041e-11Hyacinthus orientalis molecular chaperone BiP mRNA, partial cds.
JMSF027D24Sequence583000278 (24)sp|Q03684|BIP4_TOBAC1e-91Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho683010344 (23)pir|PQ0262|S218782e-41dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMSF039L09Sequence685000278 (24)sp|Q03684|BIP4_TOBAC2e-91Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho830010344 (23)sp|Q03685|BIP5_TOBAC1e-66Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF044O09Sequence711000278 (24)sp|Q03685|BIP5_TOBACe-126Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho660010344 (23)pir|PQ0262|S218789e-38dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMSF045O08Sequence780000278 (24)sp|Q03684|BIP4_TOBACe-103Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho765010344 (23)sp|Q03685|BIP5_TOBAC5e-70Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF051O08Sequence627000278 (24)sp|Q03684|BIP4_TOBAC2e-80Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho761010344 (23)sp|Q03685|BIP5_TOBAC2e-51Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein ho
JMSF052K17Sequence605000278 (24)sp|Q03684|BIP4_TOBAC3e-77Luminal binding protein 4 precursor (BiP 4) (78 kDa glucose-regulated protein ho888010344 (23)pir|S21881|S218811e-78dnaK-type molecular chaperone blp8 - common tobacco (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044O09+ AGTACTTCCACCAACCAGGACAATTTCATCAATCTGGTTTTTCTGTAACCC
                      ____________________________________________________________
consensus AGTACTTCCACCAACCAGGACAATTTCATCAATCTGGTTTTTCTGTAACCC
 
. : . : . : . : . : . :
JMSF044O09+ AGCATCCTCCATAGCCTTCTTAACAGGCCCCATAGTCTTTCTAAACAAATCATTGTTCAA
                      ____________________________________________________________
consensus AGCATCCTCCATAGCCTTCTTAACAGGCCCCATAGTCTTTCTAAACAAATCATTGTTCAA
 
. : . : . : . : . : . :
JMSF044O09+ CTCCTCAAAACGAGCCCGAGTAAGCGGTTCTGAGAAGTCATTACCATCAAAAAGAGATTC
                      ____________________________________________________________
consensus CTCCTCAAAACGAGCCCGAGTAAGCGGTTCTGAGAAGTCATTACCATCAAAAAGAGATTC
 
. : . : . : . : . : . :
JMSF044O09+ AATCTCTACACGAACTTGATGCTGGCTGCTCAGAGCCCTCTTTGCCCGTTCACATTCCCT
                      ____________________________________________________________
consensus AATCTCTACACGAACTTGATGCTGGCTGCTCAGAGCCCTCTTTGCCCGTTCACATTCCCT
 
. : . : . : . : . : . :
JMSF044O09+ CCTGAGTTTTCCAAGAGCCCTGTTGTCCTTGCTGATGTCCTTACCATGCTTCTTCTTGAT
                      ____________________________________________________________
consensus CCTGAGTTTTCCAAGAGCCCTGTTGTCCTTGCTGATGTCCTTACCATGCTTCTTCTTGAT
 
. : . : . : . : . : . :
JMSF044O09+ CAATTTAATGAAATACTCCATGATTCTCTGATCAAAATCTTCACCTCCAAGGTGAGTATC
                      ____________________________________________________________
consensus CAATTTAATGAAATACTCCATGATTCTCTGATCAAAATCTTCACCTCCAAGGTGAGTATC
 
. : . : . : . : . : . :
JMSF044O09+ TCCATTGGTGGAAAGAACCTCAAACACACCATTATCAATAGTTAGGATACTGACATCAAA
                      ____________________________________________________________
consensus TCCATTGGTGGAAAGAACCTCAAACACACCATTATCAATAGTTAGGATACTGACATCAAA
 
. : . : . : . : . : . :
JMSF044O09+ CGTTCCACCACCAAGGTCAAAGACAAGAATGTTCTTTTCACCGCCTTTCTTGTCCAATCC
JMSF024L24+ CCACCAAGGTCAANGACAAGAATGTTCTTTTCACCGCCTTTCTTGTCCAATCC
JMSF045O08+ TCC
                      ____________________________________________________________
consensus CGTTCCACCACCAAGGTCAAAGACAAGAATGTTCTTTTCACCGCCTTTCTTGTCCAATCC
 
. : . : . : . : . : . :
JMSF044O09+ ATAGGCAATGGCAGCTGCAGTTGGTTCATTGATAA-TCCTAGCCACATTCAATCCAGCAA
JMSF024L24+ ATAGGCAATGGCAGCTGCAGTTGGTTCATTGATAA-TCCTAGCCACATTCAATCCAGCAA
JMSF045O08+ ATAGGCAATGGCAGCTGCAGNTGGTTCATTGATAATTCCTAGCCACATTCAATCCAGCAA
                      ____________________________________________________________
consensus ATAGGCAATGGCAGCTGCAGTTGGTTCATTGATAA-TCCTAGCCACATTCAATCCAGCAA
 
. : . : . : . : . : . :
JMSF044O09+ TGATGCCTGCATCCTTAGTAGCTTGCCTCTGAGCATCATTGAAGTATGCTGGAACAGTGA
JMSF027D24+ TCCTTAGTAGCTTGCCTCTGAGCATCATTGAAGTATGCTGGAACAGTGA
JMSF024L24+ TGATGCCTGCATCCTTAGTAGCTTGCCTCTGAGCATCATTGAAGTATGCTGGAACAGTGA
JMSF039L09+ GAGCATCATTGAAGTATGCTGGAACAGTGA
JMSF045O08+ TGATGCCTGCATCCTTAGTAGCTTGCCTCTGAGCATCATTGAAGTATGCTGGAACAGTGA
                      ____________________________________________________________
consensus TGATGCCTGCATCCTTAGTAGCTTGCCTCTGAGCATCATTGAAGTATGCTGGAACAGTGA
 
. : . : . : . : . : . :
JMSF044O09+ CAACTGCATCCTTGATTGTCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMSF027D24+ CAACTGCATCCTTGATNGTCTTTCCAAGGTAAGCNTCAGCTGTTTCCTTCATCTTAGTAA
JMSF024L24+ CAACTGCATCCTTGATTGTCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMSF051O08+ CAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMSF039L09+ CAACTGCATCCTTGATTGTCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMFS153D02+ TCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMSF045O08+ CAACTGCATCCTTGATTGTCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMFF043L08+ TTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
JMSF052K17+ TCTTAGTAA
JMFF047N14+ AAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
                      ____________________________________________________________
consensus CAACTGCATCCTTGATTGTCTTTCCAAGGTAAGCTTCAGCTGTTTCCTTCATCTTAGTAA
 
. : . : . : . : . : . :
JMSF044O09+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMSF027D24+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTNTGATCTTGA
JMSF024L24+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMSF051O08+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTNGGTTTCACCATCTTTGATCTTGA
JMSF039L09+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMFS153D02+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMSF045O08+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMFF043L08+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMSF052K17+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMFF004M11+ TCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMFF034L08+ TCACCATCTTTGATCTTGA
JMFF027L08+ TCACCATCTTTGATCTTGA
JMFF001A12+ CTTTGATCTTGA
JMFF035J20+ TCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
JMFF047N14+ GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
                      ____________________________________________________________
consensus GAATCATGGCACTAATCTCCTCAGGGCTGAAAACCTTGGTTTCACCATCTTTGATCTTGA
 
. : . : . : . : . : . :
JMSF044O09+ C
JMSF027D24+ CTNGTATATATGGTTTTCCATCCTTGTTAACAATTTNGTAAGGAACAAGTTTCATGTCCC
JMSF024L24+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMSF051O08+ CTNGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMSF039L09+ CTNGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFS153D02+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMSF045O08+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF043L08+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMSF052K17+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF004M11+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF034L08+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF027L08+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF001A12+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF035J20+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF010M12+ AATTTTGTAAGGAACAAGTTTCATGTCCC
JMFF030E07+ AGGAACAAGTTTCATGTCCC
JMFF023G05+ TAAGGAACAAGTTTCATGTCCC
JMFF047N14+ CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
                      ____________________________________________________________
consensus CTTGTATATATGGTTTTCCATCCTTGTTAACAATTTTGTAAGGAACAAGTTTCATGTCCC
 
. : . : . : . : . : . :
JMSF027D24+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMSF024L24+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMSF051O08+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMSF039L09+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFS153D02+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMSF045O08+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF043L08+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMSF052K17+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF004M11+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF034L08+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF027L08+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF001A12+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF035J20+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF010M12+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF030E07+ TTTGCACTTCTTTGTCTTCAAACTTTCTTNCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF023G05+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF047N14+ TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
JMFF005K09+ TCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
                      ____________________________________________________________
consensus TTTGCACTTCTTTGTCTTCAAACTTTCTTCCAATAAGCCTCTTTACATCAAAAATCGTCC
 
. : . : . : . : . : . :
JMSF027D24+ TCTCAGGGTTGGAAGCGGCTAGATTCTNGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMSF024L24+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMSF051O08+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMSF039L09+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFS153D02+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMSF045O08+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF043L08+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMSF052K17+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF004M11+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF034L08+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF027L08+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF001A12+ TCTCAGGTTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF035J20+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF010M12+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF030E07+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF023G05+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF047N14+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
JMFF005K09+ TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
                      ____________________________________________________________
consensus TCTCAGGGTTGGAAGCGGCTAGATTCTTGGCTGCCTCACCAATTAGTCTCTCACTGTCAG
 
. : . : . : . : . : . :
JMSF027D24+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMSF024L24+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMSF051O08+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGNTATGATCTCTACAC
JMSF039L09+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFS153D02+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMSF045O08+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF043L08+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMSF052K17+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF004M11+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF034L08+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF027L08+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF001A12+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF035J20+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF010M12+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF030E07+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF023G05+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF047N14+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
JMFF005K09+ TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
                      ____________________________________________________________
consensus TGAAGGCAACCCATGATGGTGTGATACGATTACCTTGGTCATTGGCTATGATCTCTACAC
 
. : . : . : . : . : . :
JMSF027D24+ GCTGATCTTNGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF024L24+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF051O08+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF039L09+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFS153D02+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF045O08+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF043L08+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF052K17+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF004M11+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF034L08+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF027L08+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF001A12+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF035J20+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF010M12+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF030E07+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF023G05+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMFF047N14+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF011J20+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
JMSF011D11+ ATCTATTCCAATCACAG
JMFF005K09+ GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
                      ____________________________________________________________
consensus GCTGATCTTTGTAAACTCCAACACAGGAATAAGTTGTTCCAAGATCTATTCCAATCACAG
 
. : . : . : . : . : . :
JMSF027D24+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF024L24+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF051O08+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF039L09+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFS153D02+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF045O08+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF043L08+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF052K17+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF004M11+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCGAATAAGCTCCCGATAACAA
JMFF034L08+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCGAATAAGCTCCCGATAACAA
JMFF027L08+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF001A12+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF035J20+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF010M12+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF030E07+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF023G05+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMFF047N14+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF011J20+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF011D11+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
JMSF012A24+ AAAAGGCAAATAAGCTCCCGATAACAA
JMSF008A07+ AAAAGGCAAATAAGCTCCCGATAACAA
JMFF005K09+ TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
                      ____________________________________________________________
consensus TCCCTAATTTGGATGCTTCCTCTTTTGCGATTGAAAAGGCAAATAAGCTCCCGATAACAA
 
. : . : . : . : . : . :
JMSF027D24+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTG
JMSF024L24+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTG
JMSF051O08+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF039L09+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFS153D02+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF045O08+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF043L08+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF052K17+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF004M11+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF034L08+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF027L08+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF001A12+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF035J20+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF010M12+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF030E07+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF023G05+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF047N14+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF011J20+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF011D11+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF030F21+ CCAGCCATTGCTCGAG
JMSF012A24+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMSF008A07+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
JMFF005K09+ CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
                      ____________________________________________________________
consensus CGATTCCGAAAAGGATCGAGGACGTGCGCCTCTTCCACGCACCACCAGCCATTGCTCGAG
 
. : . : . : . : . : . :
JMSF051O08+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF039L09+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFS153D02+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF045O08+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF043L08+ GATCAGATTGAGTTTTCGTTCCCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF052K17+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF004M11+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF034L08+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF027L08+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF001A12+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF035J20+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF010M12+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF030E07+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF023G05+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF047N14+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF011J20+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF011D11+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF030F21+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF012A24+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMSF008A07+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
JMFF005K09+ GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
                      ____________________________________________________________
consensus GATCAGATTGAGTTTTCGTTCTCGCAAGTTAGAAATGGTTCCACTGTTCTATCTCTACTT
 
. : . : . : . : . : . :
JMSF051O08+ TTCCGTGAATTTTTACAGAGATCAGAGACNGAGTATAAAAGAGAAGCCGT
JMSF039L09+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGT
JMFS153D02+ TTCCGTGAATTTTTACAGAGATCAGAGACTGA
JMSF045O08+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTC
JMFF043L08+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGAAGTCAGT
JMSF052K17+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTC
JMFF004M11+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAG
JMFF034L08+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTC
JMFF027L08+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCG
JMFF001A12+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCATAGTC
JMFF035J20+ TTCC
JMFF010M12+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGCAGTC
JMFF030E07+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTCAGT
JMFF023G05+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTCAGT
JMFF047N14+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTCAGT
JMSF011J20+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAG
JMSF011D11+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAG
JMFF030F21+ TTCCGTGAATTTNTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTC
JMSF012A24+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTC
JMSF008A07+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGT
JMFF005K09+ TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTCAGTTTT
                      ____________________________________________________________
consensus TTCCGTGAATTTTTACAGAGATCAGAGACTGAGTATAAAAGAGAAGCCGTAGTCAGTTTT