Previous Contig 000277:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K03Sequence483000277 (7)gb:NTU64926_16918721e-15Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.800020748gb:NTU64926_16918721e-50Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.
JMFF021N19Sequence463000277 (7)gb:NTU64926_16918721e-11Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.745000277 (7)gb:NTU64926_16918727e-51Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.
JMFF029C17Sequence585000277 (7)gb:NTU64926_16918724e-32Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.788000277 (7)gb:NTU64926_16918721e-50Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.
JMFF037L20Sequence566000277 (7)gb:NTU64926_16918727e-29Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.767000277 (7)gb:NTU64926_16918729e-51Nicotiana tabacum geranylgeranylated protein NTGP5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021N19- AGAGTATAGCATTCCTTGTCTTAACAACCCAG
rJMFF037L20- AGAGTATAGCATTCCTTGTCTTAACAACCCAG
rJMFF029C17- TAGAGTATAGCATTCCTTGTCTTAACAACCCAG
                      ____________________________________________________________
consensus TAGAGTATAGCATTCCTTGTCTTAACAACCCAG
 
. : . : . : . : . : . :
rJMFF021N19- TAACAATGAATTCCAAACTAAAACCCAAAGCCAAACTATGATCTTTTTCAACAATAATGT
rJMFF037L20- TAACAATGAATTCCAAACTAAAACCCAAAGCCAAACTATGATCTTTTTCAACAATAATGT
rJMFF029C17- TAACAATGAATTCCAAACTAAAACCCAAAGCCAAACTATGATCTTTTTCAACAATAATGT
                      ____________________________________________________________
consensus TAACAATGAATTCCAAACTAAAACCCAAAGCCAAACTATGATCTTTTTCAACAATAATGT
 
. : . : . : . : . : . :
rJMFF021N19- TTTTTTACATTGTTGGTGCCCACAGAACATAAAATATGAAAAAGGTTGGTTTTCAAAGTT
rJMFF037L20- TTTTTTACATTGTTGGTGCCCACAGAACATAAAATATGAAAAAGGTTGGTTTTCAAAGTT
rJMFF029C17- TTTTTTACATTGTTGGTGCCCACAGAACATAAAATATGAAAAAGGTTGGTTTTCAAAGTT
                      ____________________________________________________________
consensus TTTTTTACATTGTTGGTGCCCACAGAACATAAAATATGAAAAAGGTTGGTTTTCAAAGTT
 
. : . : . : . : . : . :
rJMFF021N19- CCTACCAAGCAATCCACCATATCACTTTCTTGCCTTCTGCCAACTTTTACCAGGGAATTC
rJMFF037L20- CCTACCAAGCAATCCACCATATCACTTTCTTGCCTTCTGCCAACTTTTACCAGGGAATTC
rJMFF029C17- CCTACCAAGCAATCCACCATATCACTTTCTTGCCTTCTGCCAACTTTTACCAGGGAATTG
                      ____________________________________________________________
consensus CCTACCAAGCAATCCACCATATCACTTTCTTGCCTTCTGCCAACTTTTACCAGGGAATTC
 
. : . : . : . : . : . :
rJMFF021N19- CAATTTGCAAGATCCTGTGTTGATGAGAATGACAAGGTACCACGACTTCAACAATACTAG
rJMFF037L20- CAATTTGCAAGATCCTGTGTTGATGAGAATGACAAGGTACCACGACTTCAACAATACTAG
rJMFF029C17- CAATTTGCAAGATCCTGTGTTGATGAGAATGACAAGGTACCACGACTTCAACAATACTAG
                      ____________________________________________________________
consensus CAATTTGCAAGATCCTGTGTTGATGAGAATGACAAGGTACCACGACTTCAACAATACTAG
 
. : . : . : . : . : . :
rJMFF021N19- ATCCCAAGGAACGCCGCCAATTTGTGTTGATAATATAGAACGAAGATGAAGAAGCTGAAT
rJMFF037L20- ATCCCAAGGAACGCCGCCAATTTGTGTTGATAATATAGAACGAAGATGAAGAAGCTGAAT
rJMFF029C17- ATCCCAAGGAACGCCGCCAATTTGTGTTGATAATATAGAACGAAGATGAAGAAGCTGAAT
                      ____________________________________________________________
consensus ATCCCAAGGAACGCCGCCAATTTGTGTTGATAATATAGAACGAAGATGAAGAAGCTGAAT
 
. : . : . : . : . : . :
rJMFF021N19- TAGGTTATCTGTCAGATGAGTTACAAGATTGAACATGAACACCCGCCCTTTATTGGGGTA
rJMFF037L20- TAGGTTATCTGTCAGATGAGTTACAAGATTGAACATGAACACCCGCCCTTTATTGGGGTA
rJMFF029C17- TAGGTTATCTGTCAGATGAGTTACAAGATTGAACATGAACACCCGCCCTTTATTGGGGTA
                      ____________________________________________________________
consensus TAGGTTATCTGTCAGATGAGTTACAAGATTGAACATGAACACCCGCCCTTTATTGGGGTA
 
. : . : . : . : . : . :
rJMFF021N19- TCATCGTGCAGTTTATCATTGTTTTTGTCCACCATGGGAGGGCGCACGACAACATGCATA
rJMFF037L20- TCATCGTGCAGTTTATCATTGTTTTTGTCCACCATGGGAGGGCGCACGACAACATGCATA
rJMFF029C17- TCATCGTGCAGTTTATCATTGTTTTTGTCCACCATGGGAGGGCGCACGACAACATGCATA
                      ____________________________________________________________
consensus TCATCGTGCAGTTTATCATTGTTTTTGTCCACCATGGGAGGGCGCACGACAACATGCATA
 
. : . : . : . : . : . :
rJMFF021N19- GTGATGACACCACCTGCAACTTCAGCGACTGGAAGTCTAGATTCAGAAAGCGTTCTGTTG
rJMFF037L20- GTGATGACACCACCTGCAACTTCAGCGACTGGAAGTCTAGATTCAGAAAGCGTTCTGTTG
rJMFF029C17- GTGATGACACCACCTGCAACTTCAGCGACTGGAAGTCTAGATTCAGAAAGCGTTCTGTTG
JMFF037L20+ GTCTAGATTCAGAAAGCGTTCTGTTG
JMFF029C17+ GCAACTTCAGCGACTGGAAGTCTAGATTCAGAAAGCGTTCTGTTG
                      ____________________________________________________________
consensus GTGATGACACCACCTGCAACTTCAGCGACTGGAAGTCTAGATTCAGAAAGCGTTCTGTTG
 
. : . : . : . : . : . :
rJMFF021N19- TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
rJMFF037L20- TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
rJMFF029C17- TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
JMFF037L20+ TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
JMFF029C17+ TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
JMFF005K03+ TTT
                      ____________________________________________________________
consensus TTTTCCAGTATCTTTCCAGCATTAATAAGCTTCACATCATTGATCGTCTTGGGTCCATTT
 
. : . : . : . : . : . :
rJMFF021N19- TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
rJMFF037L20- TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
rJMFF029C17- TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
JMFF037L20+ TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
JMFF029C17+ TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
JMFF021N19+ TTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
JMFF005K03+ TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
                      ____________________________________________________________
consensus TCTTTATCTTTGGGCCATTGTGCAATTATCTTCTCTTTGAGGGATCCCACAGTGCTACTA
 
. : . : . : . : . : . :
rJMFF021N19- NGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
rJMFF037L20- GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
rJMFF029C17- GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
JMFF037L20+ GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
JMFF029C17+ GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
JMFF021N19+ GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
JMFF005K03+ GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
                      ____________________________________________________________
consensus GGACTATACTTGTTTGGTCCAATATCACTGCCATCAGCAAGCCTGAATTTGATCTCAACC
 
. : . : . : . : . : . :
rJMFF021N19- AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACAC
rJMFF037L20- AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACNAACCAA
rJMFF029C17- AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
JMFF037L20+ AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
JMFF029C17+ AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
JMFF021N19+ AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
JMFF005K03+ AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
                      ____________________________________________________________
consensus AACTCTGCTACAGCCATTGAAACACCTCTTCAGATTCTCATAATACACTACACAAACCAA
 
. : . : . : . : . : . :
rJMFF037L20- TCCCCTCAGTAACC
rJMFF029C17- TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATT
JMFF037L20+ TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATTCCCCTTCCCCTTCCAAATCAGAAAA
JMFF029C17+ TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATTCCCCTTCCCCTTCCAAATCAGAAAA
JMFF021N19+ TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATTCCCCTTCCCCTTCCAAATCAGAAAA
JMFF005K03+ TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATTCCCCTTCCCCTTCCAAATCAGAAAA
                      ____________________________________________________________
consensus TCCCCTCAGTAACCAGCCTAAATCTTGATCCTATTCCCCTTCCCCTTCCAAATCAGAAAA
 
. : . : . : . : . : . :
JMFF037L20+ ATAGAGCCAATATGAACACAAGCCCAGATCAACAACTCAAAATCCCAATAAAATAACAAA
JMFF029C17+ ATAGAGCCAATATGAACACAAGCCCAGATCAACAACTCAAAATCCCAATAAAATAACAAA
JMFF021N19+ ATAGAGCCAATATGAACACAAGCCCAGATCAACAACTCAAAATCCCAATAAAATAACAAA
JMFF005K03+ ATAGAGCCAATATGAACACAAGCCCAGATCAACAACTCAAAATCCCAATAAAATAACAAA
                      ____________________________________________________________
consensus ATAGAGCCAATATGAACACAAGCCCAGATCAACAACTCAAAATCCCAATAAAATAACAAA
 
. : . : . : . : . : . :
JMFF037L20+ GACCCAGATCAAGTTTCTCAAAACACACCCTGCATACTCTCACGCTAGACCCAAAGAATG
JMFF029C17+ GACCCAGATCAAGTTTCTCAAAACACACCCTGCATACTCTCACGCTAGACCCAAAGAATG
JMFF021N19+ GACCCAGATCAAGTTTCTCAAAACACACCCTGCATACTCTCACGCTAGACCCAAAGAATG
JMFF005K03+ GACCCAGATCAAGTTTCTCAAAACACACCCTGCATACTCTCACGCTAGACCCAAAGAATG
                      ____________________________________________________________
consensus GACCCAGATCAAGTTTCTCAAAACACACCCTGCATACTCTCACGCTAGACCCAAAGAATG
 
. : . : . : . : . : . :
JMFF037L20+ ACCTAATAATCCACACCCCAGATCAATACTCAAGTACAGAGATGGAAAATCACTGGAGAT
JMFF029C17+ ACCTAATAATCCACACCCCAGATCAATACTCAAGTACAGAGATGGAAAATCACTGGAGAT
JMFF021N19+ ACCTAATAATCCACACCCCAGATCAATACTCAAGTACAGAGATGGAAAATCACTGGAGAT
JMFF005K03+ ACCTAATAATCCACACCCCAGATCAATACTCAAGTACAGAGATGGAAAATCACTGGAGAT
                      ____________________________________________________________
consensus ACCTAATAATCCACACCCCAGATCAATACTCAAGTACAGAGATGGAAAATCACTGGAGAT
 
. : . : . : . : . : . :
JMFF037L20+ AAACAAAAATCAATTTGGAAACTTCTTAATAACAGTAACCAAGGAAGGAAGTCTCAATTT
JMFF029C17+ AAACAAAAATCAATTTGGAAACTTCTTAATAACAGTAACCAAGGAAGGAAGTCTCAATTT
JMFF021N19+ AAACAAAAATCAATTTGGAAACTTCTTAATAACAGTAACCAAGGAAGGAAGTCTCAATTT
JMFF005K03+ AAACAAAAATCAATTTGGAAACTTCTTAATAACAGTAACCAAGGAAGGAAGTCTCAATTT
                      ____________________________________________________________
consensus AAACAAAAATCAATTTGGAAACTTCTTAATAACAGTAACCAAGGAAGGAAGTCTCAATTT