Previous Contig 000276:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005J24Sequence261000276 (5)719008390 (3)pir|A84581|A845813e-52probable disease resistance protein [imported] - Arabidopsis thaliana>gb:AC00516
JMFS030F09Sequence474000276 (5)gb:AP002048_18216639e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS058D06Sequence597000276 (5)pir|T13435|T134356e-19hypothetical protein T17A13.60 - Arabidopsis thaliana>gb:ATCHRIV70_1546845 Arabi
JMSF011P05Sequence223000276 (5)654008390 (3)pir|T13435|T134358e-58hypothetical protein T17A13.60 - Arabidopsis thaliana>gb:ATCHRIV70_1546845 Arabi
JMSF049K05Sequence223000276 (5)716008390 (3)pir|T13435|T134357e-52hypothetical protein T17A13.60 - Arabidopsis thaliana>gb:ATCHRIV70_1546845 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS058D06+ AACTCAGTGAGGGAA
                      ____________________________________________________________
consensus AACTCAGTGAGGGAA
 
. : . : . : . : . : . :
JMFS058D06+ ACAAGGTCTCTAAAGGTTTCTGGGATTGTGCCTGAAAATCTGTTGGTGTTGAGGTGGAGG
                      ____________________________________________________________
consensus ACAAGGTCTCTAAAGGTTTCTGGGATTGTGCCTGAAAATCTGTTGGTGTTGAGGTGGAGG
 
. : . : . : . : . : . :
JMFS058D06+ AGGGAGAGGTCTGTTAACAAAGAAAGCTCTTTTACAAGAACCCCTTTGAGATTTGCATGG
JMFS030F09+ AGATTTGCATGG
                      ____________________________________________________________
consensus AGGGAGAGGTCTGTTAACAAAGAAAGCTCTTTTACAAGAACCCCTTTGAGATTTGCATGG
 
. : . : . : . : . : . :
JMFS058D06+ TTTAGATCTATACCTGCCACAACTTCATCTGGGTTGCCCATAAAATCTTGAGAGTCTGAG
JMFS030F09+ TTTAGATCTATACCTGCCACAACTTCATCTGGGTTGCCCATAAAATCTTGAGAGTCTGAG
                      ____________________________________________________________
consensus TTTAGATCTATACCTGCCACAACTTCATCTGGGTTGCCCATAAAATCTTGAGAGTCTGAG
 
. : . : . : . : . : . :
JMFS058D06+ CAGAAAACCCCTTTGTAATCACACACATTTGACCCAACCCATGACTTCAAAATCCCCAAT
JMFS030F09+ CAGAAAACCCCTTTGTAATCACACACATTTGACCCAACCCATGACTTCAAAATCCCCAAT
                      ____________________________________________________________
consensus CAGAAAACCCCTTTGTAATCACACACATTTGACCCAACCCATGACTTCAAAATCCCCAAT
 
. : . : . : . : . : . :
JMFS058D06+ GGGTCCTCAGAAACTGCAGATTTCAATGCTTGCAGAGCAGTGTATCCTTTTTGAAGCTTT
JMFS030F09+ GGGTCCTCAGAAACTGCAGATTTCAATGCTTGCAGAGCAGTGTATCCTTTTTGAAGCTTT
                      ____________________________________________________________
consensus GGGTCCTCAGAAACTGCAGATTTCAATGCTTGCAGAGCAGTGTATCCTTTTTGAAGCTTT
 
. : . : . : . : . : . :
JMFS058D06+ GAGCCACCACCAGAAGAGCCTGTTGGCCCTGGACTGTTGATTCCTCCACCAATCCAAACC
JMFS030F09+ GAGCCACCACCAGAAGAGCCTGTTGGCCCTGGACTGTTGATTCCTCCACCAATCCAAACC
JMSF049K05+ CAAACC
JMSF011P05+ CAAACC
JMFF005J24+ ATTCCTCCACCAATCCAAACC
                      ____________________________________________________________
consensus GAGCCACCACCAGAAGAGCCTGTTGGCCCTGGACTGTTGATTCCTCCACCAATCCAAACC
 
. : . : . : . : . : . :
JMFS058D06+ CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
JMFS030F09+ CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
JMSF049K05+ CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
JMSF011P05+ CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
JMFF005J24+ CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
                      ____________________________________________________________
consensus CCTCCACCACCACCACCACCGCCGCCGCCGCCCATTCCAATTCCAACTCCAACCCCAACA
 
. : . : . : . : . : . :
JMFS058D06+ CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
JMFS030F09+ CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
JMSF049K05+ CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
JMSF011P05+ CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
JMFF005J24+ CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
                      ____________________________________________________________
consensus CCACCACTAACAGTCACAGTCACTGCAGCCTCAATGGCAATGGCATGAAGGAGAAGAGCA
 
. : . : . : . : . : . :
JMFS058D06+ AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
JMFS030F09+ AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
JMSF049K05+ AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
JMSF011P05+ AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
JMFF005J24+ AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
                      ____________________________________________________________
consensus AAAAGAAGCCAGCTTTTTGCCATATTTCACCAACAGTCAAGATTCCAATTTGAGAGGAGT
 
. : . : . : . : . : . :
JMFS058D06+ TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGC
JMFS030F09+ TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGC
JMSF049K05+ TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGC
JMSF011P05+ TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGC
JMFF005J24+ TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGCATTGATGATGGAGGAAGTGTAAAT
                      ____________________________________________________________
consensus TTCTTGTAAGGTTGTGCAAATGTGGTTAGTTGCTGCATTGATGATGGAGGAAGTGTAAAT