Previous Contig 000275:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H13Sequence491000275 (8)pir|T04120|T041204e-42hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N674009190 (11)gb:AY706757_16237594e-49Hevea brasiliensis 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR1) mRNA,
JMFF005J16Sequence471000275 (8)pir|T04120|T041205e-35hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N483009190 (11)pir|T04120|T041204e-11hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N
JMFF011F20Sequence428000275 (8)pir|T04120|T041202e-34hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N675009190 (11)gb:AY706757_16237594e-49Hevea brasiliensis 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR1) mRNA,
JMFF022F12Sequence427000275 (8)pir|T04120|T041202e-34hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N765009190 (11)sp|P48020|HMD1_SOLTU4e-663-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (EC 1.1.1.34) (HMG- CoA reduct
JMFF024A20Sequence421000275 (8)pir|T04120|T041208e-33hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N742009190 (11)sp|P48020|HMD1_SOLTU6e-613-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (EC 1.1.1.34) (HMG- CoA reduct
JMFF038A22Sequence435000275 (8)pir|T04120|T041205e-35hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N685009190 (11)gb:AY706757_16237591e-49Hevea brasiliensis 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR1) mRNA,
JMSF034M17Sequence673000275 (8)pir|T04120|T041201e-46hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N698009190 (11)sp|P48020|HMD1_SOLTU2e-553-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (EC 1.1.1.34) (HMG- CoA reduct
JMSF043J23Sequence710000275 (8)pir|T04120|T041204e-52hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - common tobacco>gb:N734009190 (11)gb:AF004233_17606823e-63Nicotiana tabacum hydroxy-methyl-glutaryl-coenzyme A reductase (HMGRL) mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034M17+ ACGGAGCTGATAATCTC
JMSF043J23+ CGATTCCAACAAATAGGACGGAGTTTTCCCCGCCACAACGGAGNTGATAATCTC
                      ____________________________________________________________
consensus CGATTCCAACAAATAGGACGGAGTTTTCCCCGCCACAACGGAGCTGATAATCTC
 
. : . : . : . : . : . :
JMSF034M17+ CTCGTCCTCNTCAGACCCGTCCGGTGCAATTAAGAGAGCTGGTTTTTCAGCCACGCCGTT
JMSF043J23+ CTCGTCCTCCTCAGACCCGTCCGGTGCAATTAAGAGAGCTGGTTTCTCAGCCACGCCGTT
                      ____________________________________________________________
consensus CTCGTCCTCCTCAGACCCGTCCGGTGCAATTAAGAGAGCTGGTTTTTCAGCCACGCCGTT
 
. : . : . : . : . : . :
JMSF034M17+ GGAGATCTTCGCAGGTTGCTCAGGAACCANTGAGGCAATTCGTCGAACAGGTGGTGTGGG
JMSF043J23+ GGAGATCTTCGCAGGTTGCTCAGGAACCACTGAGGCAATTCGTCGAACAGGTGGTGTGGG
                      ____________________________________________________________
consensus GGAGATCTTCGCAGGTTGCTCAGGAACCACTGAGGCAATTCGTCGAACAGGTGGTGTGGG
 
. : . : . : . : . : . :
JMSF034M17+ TGGGGGAATAGCGCAGCCCAGAGTAGTTGCCGCCGCCGCAGCCGAACAAGCCCCACGCCG
JMFF002H13+ GAACAAGCCCCACGCCG
JMSF043J23+ TGGGGGAATAGCGCAGCCCAGAGTAGTTGCCGCCGCCGCAGCCGAACAAGCCCCACGCCG
                      ____________________________________________________________
consensus TGGGGGAATAGCGCAGCCCAGAGTAGTTGCCGCCGCCGCAGCCGAACAAGCCCCACGCCG
 
. : . : . : . : . : . :
JMSF034M17+ GCTATCCTCTTCCAACAAATACTGCTCATTGCTCTCATCCTCCCCCATCCCACCCCTCCT
JMFF002H13+ GCTATCCTCTTCCAACAAATACTGCTCATTGCTNTCATCCT-CCCCATCCCACCCCTCCT
JMSF043J23+ GCTATCCTCTTCCAACAAATACTGCTCATTGCTCTCATCCT-CCCCATCCCACCCCTCCT
JMFF038A22+ CCCATCCCACCCCTCNT
JMFF022F12+ CCCACCCCTCCT
JMFF011F20+ TCCCACCCCTCCT
JMFF024A20+ T
JMFF005J16+ TTCCAACAAATACTGCTCATTGCTNTCATCCTCCCCCATCCCACCCCTCCT
                      ____________________________________________________________
consensus GCTATCCTCTTCCAACAAATACTGCTCATTGCTCTCATCCTCCCCCATCCCACCCCTCCT
 
. : . : . : . : . : . :
JMSF034M17+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF002H13+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMSF043J23+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF038A22+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF022F12+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF011F20+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF024A20+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
JMFF005J16+ GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
                      ____________________________________________________________
consensus GATTCGCCCTGTACAGAAAAGACTGCACGAACCCGATCCCAAAGAACCCCAGCAGGTAAA
 
. : . : . : . : . : . :
JMSF034M17+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
JMFF002H13+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
JMSF043J23+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
JMFF038A22+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
JMFF022F12+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAATGTCACCACATGGAGAG
JMFF011F20+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAATGTCACCACATGGAGAG
JMFF024A20+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
JMFF005J16+ TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
                      ____________________________________________________________
consensus TCACCGAGGCGATCAACGACGCCAACGCAGCCAGCTCCGACAACGTCACCACATGGAGAG
 
. : . : . : . : . : . :
JMSF034M17+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF002H13+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGN
JMSF043J23+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF038A22+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF022F12+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF011F20+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF024A20+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
JMFF005J16+ GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
                      ____________________________________________________________
consensus GCGTAGAGTTCCGGATCTTCTCCCTCCACCTCACCAGCAGAAAATACATCACCGTAAAGA
 
. : . : . : . : . : . :
JMSF034M17+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF002H13+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMSF043J23+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF038A22+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF022F12+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF011F20+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF024A20+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
JMFF005J16+ ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
                      ____________________________________________________________
consensus ACATGGTGAAAAACAACCCATTTGTCAAATACAACGGCAGGGGAAGGGCATCCGACGCCT
 
. : . : . : . : . : . :
JMSF034M17+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF002H13+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMSF043J23+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF038A22+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF022F12+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF011F20+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF024A20+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
JMFF005J16+ TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
                      ____________________________________________________________
consensus TAGGCGAGGACACTAGAAGATATTGCTGTTTATGAGCCTTAATAGTCTCACACGCCGCCG
 
. : . : . : . : . : . :
JMSF034M17+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF002H13+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMSF043J23+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF038A22+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF022F12+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF011F20+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF024A20+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
JMFF005J16+ CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
                      ____________________________________________________________
consensus CAGAGCCCTTATTAGGCCGGCAAAGCTGCTTGCTCAGACGCCGGCGAACGTCCATTCTGA
 
. : . : . : . : . : . :
JMSF034M17+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF002H13+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMSF043J23+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF038A22+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF022F12+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF011F20+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF024A20+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTAT
JMFF005J16+ GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTATGAGAG
                      ____________________________________________________________
consensus GTGGAGAAAAGCGTGGCGGTTAGATGCCGCCGTTAGAATCTGAATTTGGTTTTATGAGAG