Previous Contig 000264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005H10Sequence535000264 (2)gb:AY127021_15804754e-19Arabidopsis thaliana AT5g54930/MBG8_20 mRNA, complete cds.>gb:BT004509_1637543 A752020744
JMFS053C09Sequence572000264 (2)gb:AY127021_15804753e-21Arabidopsis thaliana AT5g54930/MBG8_20 mRNA, complete cds.>gb:BT004509_1637543 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS053C09+ GTTTCTGCTTGAATCGCTTATGTCCATGCTTTTGATTCTCTACAGGTATCTGGGTTT
                      ____________________________________________________________
consensus GTTTCTGCTTGAATCGCTTATGTCCATGCTTTTGATTCTCTACAGGTATCTGGGTTT
 
. : . : . : . : . : . :
JMFS053C09+ CGTTTCTTTGTATCATCTGAACATGTGGAGCAACATCGTTTTCTGCTGTTATAGGAACAT
JMFF005H10+ GTATCATCTGAACATGTGGAGCAACATCGTTTTCTGCTGTTATAGGAACAT
                      ____________________________________________________________
consensus CGTTTCTTTGTATCATCTGAACATGTGGAGCAACATCGTTTTCTGCTGTTATAGGAACAT
 
. : . : . : . : . : . :
JMFS053C09+ AATGTCCAGGCTTAAAGACAATGCCCCTCAAGTTGGTATTGCTGTCCCCAATTCTAATAC
JMFF005H10+ AATGTCCAGGCTTAAAGACAATGCCCCTCAAGTTGGTATTGCTGTCCCCAATTCTAATAC
                      ____________________________________________________________
consensus AATGTCCAGGCTTAAAGACAATGCCCCTCAAGTTGGTATTGCTGTCCCCAATTCTAATAC
 
. : . : . : . : . : . :
JMFS053C09+ TGAGCAAATAACCGGCATCGAACACAGCCTCAACAATACCAGTAACTGCCTTACCAACCA
JMFF005H10+ TGAGCAAATAACCGGCATCGAACACAGCCTCAACAATACCAGTAACTGCCTTACCAACCA
                      ____________________________________________________________
consensus TGAGCAAATAACCGGCATCGAACACAGCCTCAACAATACCAGTAACTGCCTTACCAACCA
 
. : . : . : . : . : . :
JMFS053C09+ TGGCGTCATTTACATCAATATTTTTCTCAATTTGCGGGGTTTGGTTATTTTTCACACTAT
JMFF005H10+ TGGCGTCATTTACATCAATATTTTTCTCAATTTGCGGGGTTTGGTTATTTTTCACACTAT
                      ____________________________________________________________
consensus TGGCGTCATTTACATCAATATTTTTCTCAATTTGCGGGGTTTGGTTATTTTTCACACTAT
 
. : . : . : . : . : . :
JMFS053C09+ CAACACCCAGTGGTCTTTGAACACTTCTCATACGAGGAAGACTGGGATCCTTCCTTGGTC
JMFF005H10+ CAACACCCAGTGGTCTTTGAACACTTCTCATACGAGGAAGACTGGGATCCTTCCTTGGTC
                      ____________________________________________________________
consensus CAACACCCAGTGGTCTTTGAACACTTCTCATACGAGGAAGACTGGGATCCTTCCTTGGTC
 
. : . : . : . : . : . :
JMFS053C09+ GGCCCCGTTTTCGCTTCATAGGGAGGGCAAGTTGGGTATTGGAATGATCCACTTGAATTG
JMFF005H10+ GGCCCCGTTTTCGCTTCATAGGGAGGGCAAGTTGGGTATTGGAATGATCCACTTGAATTG
                      ____________________________________________________________
consensus GGCCCCGTTTTCGCTTCATAGGGAGGGCAAGTTGGGTATTGGAATGATCCACTTGAATTG
 
. : . : . : . : . : . :
JMFS053C09+ CTTGGTTCATTTTCAGAAGTAAAATTAAATCGCTGCCTTATCTCTAAATCCCCAATAGTG
JMFF005H10+ CTTGGTTCATTTTCAGAAGTAAAATTAAATCGCTGCCTTATCTCTAAATCCCCAATAGTG
                      ____________________________________________________________
consensus CTTGGTTCATTTTCAGAAGTAAAATTAAATCGCTGCCTTATCTCTAAATCCCCAATAGTG
 
. : . : . : . : . : . :
JMFS053C09+ CATAAACCCTCATAAGAGAGAAACAAGGCGGCTTGCAAGAAGCGACGAAAATGGAGGAAT
JMFF005H10+ CATAAACCCTCATAAGAGAGAAACAAGGCGGCTTGCAAGAAGCGACGAAAATGGAGGAAT
                      ____________________________________________________________
consensus CATAAACCCTCATAAGAGAGAAACAAGGCGGCTTGCAAGAAGCGACGAAAATGGAGGAAT
 
. : . : . : . : . : . :
JMFS053C09+ TTGGAATTTGAAACCCTAGATTTGGGTGGGTAAGA
JMFF005H10+ TTGGAATTTGAAACCCTAGATTTGGGTGGGTAAGACTTCGGGGGACAGAAGAGTGAGAGC
                      ____________________________________________________________
consensus TTGGAATTTGAAACCCTAGATTTGGGTGGGTAAGACTTCGGGGGACAGAAGAGTGAGAGC