Previous Contig 000259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J16Sequence505000259 (8)gb:AK117224_18152698e-78Arabidopsis thaliana At3g17850 mRNA for putative protein kinase, complete cds, c761009591 (3)gb:AC082645_17331665e-34Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.
JMFF005G08Sequence497000259 (8)
JMFF009G03Sequence502000259 (8)735009591 (3)gb:AC082645_17331663e-31Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.
JMFF029I09Sequence434000259 (8)755009591 (3)gb:AC082645_17331662e-33Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence.
JMFS099H09Sequence616000259 (8)gb:AE005173_8928098e-08Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC020889_153
JMFS134C04Sequence625000259 (8)gb:BT002248_16358512e-31Arabidopsis thaliana At1g48490/T1N15_9 mRNA, complete cds.>gb:AF385743_1794634 A
JMFS135A07Sequence610000259 (8)gb:AK117224_18152693e-51Arabidopsis thaliana At3g17850 mRNA for putative protein kinase, complete cds, c
JMFS139F03Sequence626000259 (8)gb:AK117224_18152696e-52Arabidopsis thaliana At3g17850 mRNA for putative protein kinase, complete cds, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS134C04+ GCTCATTGA
                      ____________________________________________________________
consensus GCTCATTGA
 
. : . : . : . : . : . :
JMFS134C04+ CACTGAGACCCTTTTGATCACAACGATCAGCAATGGTACAAATTCTAGAGTGCTCTTCCA
                      ____________________________________________________________
consensus CACTGAGACCCTTTTGATCACAACGATCAGCAATGGTACAAATTCTAGAGTGCTCTTCCA
 
. : . : . : . : . : . :
JMFS134C04+ CATGCAAAGTGGGAACCTCCTCCTCACAAATGCGACAAATTATTGAGCTCTCATCAGAAA
                      ____________________________________________________________
consensus CATGCAAAGTGGGAACCTCCTCCTCACAAATGCGACAAATTATTGAGCTCTCATCAGAAA
 
. : . : . : . : . : . :
JMFS134C04+ GACCCGGTTGGTCTCCCCAGTAACCCCAAGAAATTTTGTGCTGGTGCTTGGAAGATCCTG
                      ____________________________________________________________
consensus GACCCGGTTGGTCTCCCCAGTAACCCCAAGAAATTTTGTGCTGGTGCTTGGAAGATCCTG
 
. : . : . : . : . : . :
JMFS134C04+ AAGAGTGTCCGTGAGAATCTCTGCTAGAAGGGGGTTCTTGATGCTTAGCATTGGCAAGAT
JMFS135A07+ AAGGGGGTTCTTGATGCTTAGCATTGGCAAGAT
                      ____________________________________________________________
consensus AAGAGTGTCCGTGAGAATCTCTGCTAGAAGGGGGTTCTTGATGCTTAGCATTGGCAAGAT
 
. : . : . : . : . : . :
JMFS134C04+ CTAAATCTGGAGTTCCTCTCTTGTTGATTGGCAACTTCGAAGCCTCTAGATTATCATTTT
JMFS135A07+ CTAAATCTGGAGTTCCTCTCTTGTTGATTGGCAACTTCGAAGCCTCTAGATTATCATTTT
                      ____________________________________________________________
consensus CTAAATCTGGAGTTCCTCTCTTGTTGATTGGCAACTTCGAAGCCTCTAGATTATCATTTT
 
. : . : . : . : . : . :
JMFS134C04+ GCTCCTTCAGGGGAGTAACTTCTTTTGGACTTTTCCCAGCAGGAGAAGGTAATTTCTTCC
JMFS135A07+ GCTCCTTCAGGGGAGTAACTTCTTTTGGACTTTTCCCAGCAGGAGAAGGTAATTTCTTCC
                      ____________________________________________________________
consensus GCTCCTTCAGGGGAGTAACTTCTTTTGGACTTTTCCCAGCAGGAGAAGGTAATTTCTTCC
 
. : . : . : . : . : . :
JMFS134C04+ AAGAAGCTATCCGATCCCTACCACCAGGAGAATCCAGATTCTTGGCAGTTTCAGTTGGCA
JMFS135A07+ AAGAAGCTATCCGATCCCTACCACCAGGAGAATCCAGATTCTTGGCAGTTTCAGTTGGCA
                      ____________________________________________________________
consensus AAGAAGCTATCCGATCCCTACCACCAGGAGAATCCAGATTCTTGGCAGTTTCAGTTGGCA
 
. : . : . : . : . : . :
JMFS134C04+ ATGACTGAAAACCCTCTGGCTGTACTGCTTGGTCTCTCTTCCAATCCAAACCATGCTGCT
JMFS135A07+ ATGACTGAAAACCCTCTGGCTGTACTGCTTGGTCTCTCTTCCAATCCAAACCATGCTGCT
                      ____________________________________________________________
consensus ATGACTGAAAACCCTCTGGCTGTACTGCTTGGTCTCTCTTCCAATCCAAACCATGCTGCT
 
. : . : . : . : . : . :
JMFS134C04+ CCTGACTATAAGATTTTCTTGTAGCAGGTGTCTTTGGAACCTTCATAGTACTGGATATTG
JMFS135A07+ CCTGACTATAAGATTTTCTTGTAGCAGGTGTCTTTGGAACCTTCATAGTACTGGATATTG
                      ____________________________________________________________
consensus CCTGACTATAAGATTTTCTTGTAGCAGGTGTCTTTGGAACCTTCATAGTACTGGATATTG
 
. : . : . : . : . : . :
JMFS134C04+ TCTGATCCATCCCCATGCCTCCAGAAATGTGTTTATCAGCAGGTTGAACTGACTGGCGAA
JMFS135A07+ TCTGATCCATCCCCATGCCTCCAGAAATGTGTTTATCAGCAGGTTGAACTGACTGGCGAA
                      ____________________________________________________________
consensus TCTGATCCATCCCCATGCCTCCAGAAATGTGTTTATCAGCAGGTTGAACTGACTGGCGAA
 
. : . : . : . : . : . :
JMFS134C04+ GCTGCAACATAGGTTC
JMFS135A07+ GCTGCAACATAGGTTCATCCTCAGCAAAACTTTCCTTGTGGAACTGAAGCAATCGAGTAC
JMFF003J16+ AAAACTTTCCTTGTGGAACTGAAGCAATCGAGTAC
                      ____________________________________________________________
consensus GCTGCAACATAGGTTCATCCTCAGCAAAACTTTCCTTGTGGAACTGAAGCAATCGAGTAC
 
. : . : . : . : . : . :
JMFS135A07+ ACCTTGTGAGTATAAAAAGCATTCGAGTATGCAGCTTCTTCAACATACCCGTGGGAAGCT
JMFF003J16+ NCCTTGTGAGTATAAAAAGCATTCGAGTATGCAGCTTCTTCAACATACCCGTGGGAAGCT
                      ____________________________________________________________
consensus ACCTTGTGAGTATAAAAAGCATTCGAGTATGCAGCTTCTTCAACATACCCGTGGGAAGCT
 
. : . : . : . : . : . :
JMFS135A07+ CCTGACGCCTATCATCTATCTCCTGAACAATTCCTTCACACTGAAGCCAAAATTCCCCAG
JMFF003J16+ CCTGACGCCTATCATCTATCTCCTGAACAATTCCTTCACACTGAAGCCAAAATTCCCCAG
                      ____________________________________________________________
consensus CCTGACGCCTATCATCTATCTCCTGAACAATTCCTTCACACTGAAGCCAAAATTCCCCAG
 
. : . : . : . : . : . :
JMFS135A07+ GTGATGTCATTGCACAGTTTCGGGCCAAAATCAGCAA
JMFF003J16+ GTGATGTCATTGCACAGTTTCGGGCCAAAATCAGCAAGTCCTCAATTGTTTCCTGCCATT
                      ____________________________________________________________
consensus GTGATGTCATTGCACAGTTTCGGGCCAAAATCAGCAAGTCCTCAATTGTTTCCTGCCATT
 
. : . : . : . : . : . :
JMFF003J16+ CAGGATGAGTTTCTGCATTCTTTTCTAAAACCCCAACCAGATCTGCTGCAAAGATATGAA
JMFS139F03+ GTTTCTGCATTCTTTTCTAAAACCCCAACCAGATCTGCTGCAAAGATATGAA
                      ____________________________________________________________
consensus CAGGATGAGTTTCTGCATTCTTTTCTAAAACCCCAACCAGATCTGCTGCAAAGATATGAA
 
. : . : . : . : . : . :
JMFF003J16+ GATCAGAATCAACTTCCTCCTTTGCTTTAGCAAACTTCGTCCTTATCATAGTTATAACCT
JMFS139F03+ GATCAGAATCAACTTCCTCCTTTGCTTTAGCAAACTTCGTCCTTATCATAGTTATAACCT
                      ____________________________________________________________
consensus GATCAGAATCAACTTCCTCCTTTGCTTTAGCAAACTTCGTCCTTATCATAGTTATAACCT
 
. : . : . : . : . : . :
JMFF003J16+ CCTCCAAATTATTTAAACCTCGACGCTTCCAAAATGGGAAAGGCCGTACACCTTTAGAAT
JMFS139F03+ CCTCCAAATTATTTAAACCTCGACGCTTCCAAAATGGGAAAGGCCGTACACCTTTAGAAT
                      ____________________________________________________________
consensus CCTCCAAATTATTTAAACCTCGACGCTTCCAAAATGGGAAAGGCCGTACACCTTTAGAAT
 
. : . : . : . : . : . :
JMFF003J16+ TTAATTCATGGGAAAAACTTTTGATATCAGCAGGGAACCTTTTCCTAGGTGCACTAGTCA
JMFS139F03+ TTAATTCATGGGAAAAACTTTTGATATCAGCAGGGAACCTTTTCCTAGGTGCACTAGTCA
                      ____________________________________________________________
consensus TTAATTCATGGGAAAAACTTTTGATATCAGCAGGGAACCTTTTCCTAGGTGCACTAGTCA
 
. : . : . : . : . : . :
JMFF003J16+ GACGAAGTATAGCTTGAAAGCGTGGAGATTCAGACTCCTTTGGGTTATCA
JMFS139F03+ GACGAAGTATAGCTTGAAAGCGTGGAGATTCAGACTCCTTTGGGTTATCACATTCATAAG
                      ____________________________________________________________
consensus GACGAAGTATAGCTTGAAAGCGTGGAGATTCAGACTCCTTTGGGTTATCACATTCATAAG
 
. : . : . : . : . : . :
JMFS139F03+ ATGTCTTCAAGTCTGGAGTATAAGCATCCATACTCCTCAAACCACCTGAATGGCCGCGAG
                      ____________________________________________________________
consensus ATGTCTTCAAGTCTGGAGTATAAGCATCCATACTCCTCAAACCACCTGAATGGCCGCGAG
 
. : . : . : . : . : . :
JMFS139F03+ ATGGATTGAACCGACCTGCTTCAGAAGAAGATTCACCATTTTGCAGCCTAGAAGGGACAC
                      ____________________________________________________________
consensus ATGGATTGAACCGACCTGCTTCAGAAGAAGATTCACCATTTTGCAGCCTAGAAGGGACAC
 
. : . : . : . : . : . :
JMFS139F03+ CAGGGCTTTGGTTCCTGGACCGTGCAGTCTCCATTGACATATGATCTGAATTGCTCCCAT
                      ____________________________________________________________
consensus CAGGGCTTTGGTTCCTGGACCGTGCAGTCTCCATTGACATATGATCTGAATTGCTCCCAT
 
. : . : . : . : . : . :
JMFS139F03+ TATCTACCCAACCAGAACTTTCCACTGCCCTTTTGTCCTCCTTTCCCACTGCACTCTTTA
                      ____________________________________________________________
consensus TATCTACCCAACCAGAACTTTCCACTGCCCTTTTGTCCTCCTTTCCCACTGCACTCTTTA
 
. : . : . : . : . : . :
JMFS139F03+ TTGCGGAACTCGAGTGCGGCTTAGACAGGTTACTAGCACCCAAAGAGCTTCCCTTATCTC
JMFS099H09+ GGCTTAGACAGGTTACTAGCACCCAAAGAGCTTCCCTTATCTC
                      ____________________________________________________________
consensus TTGCGGAACTCGAGTGCGGCTTAGACAGGTTACTAGCACCCAAAGAGCTTCCCTTATCTC
 
. : . : . : . : . : . :
JMFS139F03+ TACTCCCGTACCCGAAGAAGCTCTCCTGCGGCAA
JMFS099H09+ TACTCCCGTACCCGAAGAAGCTCTCCTGCGGCAACGGCCCGGATCGCGTCTTAATCTTGT
                      ____________________________________________________________
consensus TACTCCCGTACCCGAAGAAGCTCTCCTGCGGCAACGGCCCGGATCGCGTCTTAATCTTGT
 
. : . : . : . : . : . :
JMFF029I09+ AGTCGGCGGCCCCGCTT
JMFS099H09+ TCAAACCTAACGACGATGCCAGAATCGGCGACACCGACACCGCAGTCGGCGGCCCCGCTT
JMFF005G08+ AGTCGGCGGCCCCGCTT
                      ____________________________________________________________
consensus TCAAACCTAACGACGATGCCAGAATCGGCGACACCGACACCGCAGTCGGCGGCCCCGCTT
 
. : . : . : . : . : . :
JMFF029I09+ CCTTACCATCCAAGCTCCTCAGCTTAGAAGACCCCAAAGTTTCTCCGCCTCCCAATCCGG
JMFS099H09+ CCTTACCATCCAAGCTCCTCAGCTTAGAAGACCCCAAAGTTTCTCCGCCTCCCAATCCGG
JMFF005G08+ CCTTACCATCCAAGCTCCTCAGCTTAGAAGACCCCAAAGTTTCTCCGCCTCCCAATCCGG
                      ____________________________________________________________
consensus CCTTACCATCCAAGCTCCTCAGCTTAGAAGACCCCAAAGTTTCTCCGCCTCCCAATCCGG
 
. : . : . : . : . : . :
JMFF029I09+ ACTTCCCGGGAGAATTGGAACTGTGAGCTATACTCTCTTTCCCCTTACTATCCTTCTTCT
JMFS099H09+ ACTTCCCGGGAGAATTGGAACTGTGAGCTATACTCTCTTTCCCCTTACTATCCTTCTTCT
JMFF009G03+ TCCTTCTTCT
JMFF005G08+ ACTTCCCGTGAGAATTGGAACTGTGAGCTATACTCTCTTTCCCCTTACTATCCTTCTTCT
                      ____________________________________________________________
consensus ACTTCCCGGGAGAATTGGAACTGTGAGCTATACTCTCTTTCCCCTTACTATCCTTCTTCT
 
. : . : . : . : . : . :
JMFF029I09+ TATCCTTGAAGCTAGCAGCTAGACTAGAAATTGAAGTCGGAGTTGCAGGGGAGGAATTGT
JMFS099H09+ TATCCTTGAAGCTAGCAGCTAGACTAGAAATTGAAGTCGGAGTTGCAGGGGAGGAATTGT
JMFF009G03+ TATCCTTGAAGCTAGCAGCTAGACTAGAAATTGAAGTCGGAGTTGCAGGGGAGGAATTGT
JMFF005G08+ TATCCTTGAAGCTAGCAGCTAGACTAGAAATTGAAGTCGGAGTTGCAGGGGAGGAATTGT
                      ____________________________________________________________
consensus TATCCTTGAAGCTAGCAGCTAGACTAGAAATTGAAGTCGGAGTTGCAGGGGAGGAATTGT
 
. : . : . : . : . : . :
JMFF029I09+ CCTTGGAACTGGAACTGGACTTGCCCATTTTCTTATCAGATCGGATCGGGGAATTCGACC
JMFS099H09+ CCTTGGAACTGGAACTGGACTTGCCCATTTTCTTATCAGATCGGATCGGGGAATTCGACC
JMFF009G03+ CCTTGGAACTGGAACTGGACTTGCCCATTTTCTTATCAGATCGGATCGGGGAATTCGACC
JMFF005G08+ CCTTGGAACTGGAACTGGACTTGCCCATTTTCTTATCAGATCGGATCGGGGAATTCGACC
                      ____________________________________________________________
consensus CCTTGGAACTGGAACTGGACTTGCCCATTTTCTTATCAGATCGGATCGGGGAATTCGACC
 
. : . : . : . : . : . :
JMFF029I09+ CGATCGATCGCGGACTATTAGAGGATCCATCTGGGCTGGAAACATCGGCGGATTTCTTAG
JMFS099H09+ CGATCGATCGCGGACTATTAGAGGATCCATCTGGGCTGGAAACATCGGCGGATTTCTTAG
JMFF009G03+ CGATCGATCGCGGACTATTAGAGGATCCATCTGGGCTGGAAACATCGGCGGATTTCTTAG
JMFF005G08+ CGATCGATCGCGGACTATTAGAGGATCCATCTGGGCTGGAAACATCGGCGGATTTCTTAG
                      ____________________________________________________________
consensus CGATCGATCGCGGACTATTAGAGGATCCATCTGGGCTGGAAACATCGGCGGATTTCTTAG
 
. : . : . : . : . : . :
JMFF029I09+ AAGAAAAGAATCGGCCTTTGAACACCATTTTCCGTTTAATGCGTTGTTCCCCTAGGGTTT
JMFS099H09+ AAGAAAAGAATCGGCCTTTGAACACCATTTTCCGTTTAATGCGTTGTTCCCCTAGGGTTT
JMFF009G03+ AAGAAAAGAATCGGCCTTTGAACACCATTTTCCGTTTAATGCGTTGTTCCCCTAGGGTTT
JMFF005G08+ AAGAAAAGAATCGGCCTTTGAACACCATTTTCCGTTTAATGCGTTGTTCCCCTAGGGTTT
                      ____________________________________________________________
consensus AAGAAAAGAATCGGCCTTTGAACACCATTTTCCGTTTAATGCGTTGTTCCCCTAGGGTTT
 
. : . : . : . : . : . :
JMFF029I09+ TATGCTGCTATGGCGTCTTGGATTCCTCTTCAAAGCTCTATGCATGGTGGACTAGT
JMFS099H09+ TATGCTGCTATGGCGTCTTGGATTCCTCTTCAAAGCTCTATGCATGGTGGACTAGTGCAG
JMFF009G03+ TATGCTGCTATGGCGTCTTGGATTCCTCTTCAAAGCTCTATGCATGGTGGACTAGT
JMFF005G08+ TATGCTGCTATGGCGTCTTGGATTCCTCTTCAAAGCTCTATGCATGGTGGACTAGTGCAG
                      ____________________________________________________________
consensus TATGCTGCTATGGCGTCTTGGATTCCTCTTCAAAGCTCTATGCATGGTGGACTAGTGCAG
 
. : . : . : . : . : . :
JMFS099H09+ ACTGTTCCGTGTTGACTGTTGATGAAA
JMFF005G08+ ACTGTTCCGTGTTGACTGTTGATGAAAGCAGAGAAAGAGGGAGAAGTGGGTCTGAAACCC
                      ____________________________________________________________
consensus ACTGTTCCGTGTTGACTGTTGATGAAAGCAGAGAAAGAGGGAGAAGTGGGTCTGAAACCC