Previous Contig 000255:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005F09Sequence521000255 (2)sp|P93531|C7D7_SOLCH6e-40Cytochrome P450 71D7 (EC 1.14.-.-).>pir|T10499|T10499 probable cytochrome P450 (755008377 (3)gb:AF166332_17740155e-52Nicotiana tabacum cytochrome P450 gene, complete cds.
JMFF030G01Sequence405000255 (2)sp|P93531|C7D7_SOLCH6e-27Cytochrome P450 71D7 (EC 1.14.-.-).>pir|T10499|T10499 probable cytochrome P450 (650008377 (3)sp|P93531|C7D7_SOLCH1e-41Cytochrome P450 71D7 (EC 1.14.-.-).>pir|T10499|T10499 probable cytochrome P450 (

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005F09+ CCCGGATGGGCGAAAACGACGACACCCATCTTCGAGCTGAG
                      ____________________________________________________________
consensus CCCGGATGGGCGAAAACGACGACACCCATCTTCGAGCTGAG
 
. : . : . : . : . : . :
JMFF005F09+ GAGCTCTAAGATGCAGATTTTGCGCATCTGTCGCCAGTACTCGCCGTACGGAGCAAACGC
                      ____________________________________________________________
consensus GAGCTCTAAGATGCAGATTTTGCGCATCTGTCGCCAGTACTCGCCGTACGGAGCAAACGC
 
. : . : . : . : . : . :
JMFF030G01+ GGTCATGATCTTGGAGGCTAGGATTTCCGGCCGGCTGGCGAAGGC
JMFF005F09+ GATGTTTTGATTGTTGGTCATGATCTTGGAGGCTAGGATTTCCGGCCGGCTGGCGAAGGC
                      ____________________________________________________________
consensus GATGTTTTGATTGTTGGTCATGATCTTGGAGGCTAGGATTTCCGGCCGGCTGGCGAAGGC
 
. : . : . : . : . : . :
JMFF030G01+ GACGTCGTGGGTTTTCAGTACTTGTTTCGCCGCCCGGGGAGTCGATATCACCACGGCGGA
JMFF005F09+ GACGTCGTGGGTTTTCAGTACTTGTTTCGCCGCCCGGGGAGTCGATATCACCACGGCGGA
                      ____________________________________________________________
consensus GACGTCGTGGGTTTTCAGTACTTGTTTCGCCGCCCGGGGAGTCGATATCACCACGGCGGA
 
. : . : . : . : . : . :
JMFF030G01+ AATCTCCCCCAGCTGGAGGTGCATTATGCCGCCGTGTTTCGTCGCTAAATCTCTTAGAAC
JMFF005F09+ AATCTCCCCCAGCTGGAGGTGCATTATGCCGCCGTGTTTCGTCGCTAAATCTCTTAGAAC
                      ____________________________________________________________
consensus AATCTCCCCCAGCTGGAGGTGCATTATGCCGCCGTGTTTCGTCGCTAAATCTCTTAGAAC
 
. : . : . : . : . : . :
JMFF030G01+ ATGATTGGGTGGTGCTGAGCTGCCTGCCAGATGGTGGATACTTCCTATAAATGGTAATTT
JMFF005F09+ ATGATTGGGTGGTGCTGAGCTGCCTGCCAGATGGTGGATACTTCCTATAAATGGTAATTT
                      ____________________________________________________________
consensus ATGATTGGGTGGTGCTGAGCTGCCTGCCAGATGGTGGATACTTCCTATAAATGGTAATTT
 
. : . : . : . : . : . :
JMFF030G01+ CCACGGTCCCGGCGGCAGTTTTCCGGCGACACTACTAGTTTTCTTGGATTTCTTTGTAAC
JMFF005F09+ CCACGGTCCCGGCGGCAGTTTTCCGGCGACACTACTAGTTTTCTTGGATTTCTTTGTAAC
                      ____________________________________________________________
consensus CCACGGTCCCGGCGGCAGTTTTCCGGCGACACTACTAGTTTTCTTGGATTTCTTTGTAAC
 
. : . : . : . : . : . :
JMFF030G01+ GTTCTTGATTAAGTTGAATAACAGGAAGAGAAGGGTGATGAAAGCGATGATGAGGGAAAA
JMFF005F09+ GTTCTTGATTAAGTTGAATAACAGGAAGAGAAGGGTGATGAAAGCGATGATGAGGGAAAA
                      ____________________________________________________________
consensus GTTCTTGATTAAGTTGAATAACAGGAAGAGAAGGGTGATGAAAGCGATGATGAGGGAAAA
 
. : . : . : . : . : . :
JMFF030G01+ TGGAAACTTAATTTCCATTTCAACGAAAACTAAGAGAGGCAAAGAAAGGTGTAGGAATTC
JMFF005F09+ TGGAAACTTAATTTCCATTTCAACGAAAACTAAGAGAGGCAAAGAAAGGTGTAGGAATTC
                      ____________________________________________________________
consensus TGGAAACTTAATTTCCATTTCAACGAAAACTAAGAGAGGCAAAGAAAGGTGTAGGAATTC