Previous Contig 000253:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E15Sequence554000253 (3)774000253 (3)
JMFN039H10Sequence633000253 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005E15- ATTATTTAGCAGGAGAA
                      ____________________________________________________________
consensus ATTATTTAGCAGGAGAA
 
. : . : . : . : . : . :
rJMFF005E15- AACTCAACTGGGGATAAAAGGATTCCAAATAAGTGCACTCCTGCAAGAAGGAAGCAATCA
                      ____________________________________________________________
consensus AACTCAACTGGGGATAAAAGGATTCCAAATAAGTGCACTCCTGCAAGAAGGAAGCAATCA
 
. : . : . : . : . : . :
rJMFF005E15- GGAACTGGATAAAGAGACCCCATATTATCCAGCAGGACATATCTACCAAAGCATTCATCA
                      ____________________________________________________________
consensus GGAACTGGATAAAGAGACCCCATATTATCCAGCAGGACATATCTACCAAAGCATTCATCA
 
. : . : . : . : . : . :
rJMFF005E15- AACTGATCTACATAGTTATCCGCAATGCAATCAGCATCAGATTGAATAGCTATCAGCAAG
                      ____________________________________________________________
consensus AACTGATCTACATAGTTATCCGCAATGCAATCAGCATCAGATTGAATAGCTATCAGCAAG
 
. : . : . : . : . : . :
rJMFF005E15- GCACACAAGTCAGCTACAATCGATCTACATAGACATCGGCTAGCACATCACAGCTACAGC
                      ____________________________________________________________
consensus GCACACAAGTCAGCTACAATCGATCTACATAGACATCGGCTAGCACATCACAGCTACAGC
 
. : . : . : . : . : . :
rJMFF005E15- GATGCTCTCGTGCTAGAAACAAGTATCAGGTGAGGAAAATACAACCATGAACCGGCGCTA
                      ____________________________________________________________
consensus GATGCTCTCGTGCTAGAAACAAGTATCAGGTGAGGAAAATACAACCATGAACCGGCGCTA
 
. : . : . : . : . : . :
rJMFF005E15- AGGTCCAAACTTAGGGGTTTGGTGTCATATAGCTTATAGAAGGAATGCTATATAGAACCA
                      ____________________________________________________________
consensus AGGTCCAAACTTAGGGGTTTGGTGTCATATAGCTTATAGAAGGAATGCTATATAGAACCA
 
. : . : . : . : . : . :
rJMFF005E15- GCATAAGTGCATATCACAGGTTTGTGAGTCAACTGCAACTGCTACAATTAAAAGTGCACT
                      ____________________________________________________________
consensus GCATAAGTGCATATCACAGGTTTGTGAGTCAACTGCAACTGCTACAATTAAAAGTGCACT
 
. : . : . : . : . : . :
rJMFF005E15- TCACCCTCTTTCAGATGAACACCGCTAAGGCTCCAATCATTGCCGTTCAGAAAATTTGGA
                      ____________________________________________________________
consensus TCACCCTCTTTCAGATGAACACCGCTAAGGCTCCAATCATTGCCGTTCAGAAAATTTGGA
 
. : . : . : . : . : . :
rJMFF005E15- AACAAATGGGAGTTTGTCACCAGCAAACACATACACTAACAATCAACAGCGAAGTACACA
                      ____________________________________________________________
consensus AACAAATGGGAGTTTGTCACCAGCAAACACATACACTAACAATCAACAGCGAAGTACACA
 
. : . : . : . : . : . :
rJMFF005E15- CAGGAGACACAGCATCAACAGCTGTTGCAAAATCGTGCAATTCAGCAACATTCACTCGTC
                      ____________________________________________________________
consensus CAGGAGACACAGCATCAACAGCTGTTGCAAAATCGTGCAATTCAGCAACATTCACTCGTC
 
. : . : . : . : . : . :
rJMFF005E15- ACGCACATAAAAATAAGTTTCTGCAAATTTGTTCTACCAAGCACTAAACAGACGATATCA
JMFN039H10+ AAATAAGTTTCTGCAAATTGTTTCTACCAAGCACTAAACAGACGATATCA
JMFF005E15+ AAACAGACGATATCA
                      ____________________________________________________________
consensus ACGCACATAAAAATAAGTTTCTGCAAATTTTTTCTACCAAGCACTAAACAGACGATATCA
 
. : . : . : . : . : . :
rJMFF005E15- TCATCGAATGCCCCCTTCAAGGATAACAACGCTAAAATAGGAACACCATGGGAGAAATTC
JMFN039H10+ TCATCGAATGCCCCCTTCAAGGATAACAACGCTAAAATAGGAACACCAT-GGAGAAATTC
JMFF005E15+ TCATCGAATGCCCCCTTCAAGGATAACAACGCTAAAATAGGAACACCAT-GGAGAAATTC
                      ____________________________________________________________
consensus TCATCGAATGCCCCCTTCAAGGATAACAACGCTAAAATAGGAACACCAT-GGAGAAATTC
 
. : . : . : . : . : . :
rJMFF005E15- ATCAATGCTTCTTCGCTGTCACTCATCAGCATCA
JMFN039H10+ ATCAATGCTTCTTCGCTGTCACTCATCAGCATCAGAACGTGGAGACGGGCTTCGAGACTC
JMFF005E15+ ATCAATGCTTCTTCGCTGTCACTCATCAGCATCAGAACGTGGAGACGGGCTTCGAGACTC
                      ____________________________________________________________
consensus ATCAATGCTTCTTCGCTGTCACTCATCAGCATCAGAACGTGGAGACGGGCTTCGAGACTC
 
. : . : . : . : . : . :
JMFN039H10+ AGCCCCCCGGCCACGGGGTGACAAACTTCTTGGAGTTGGAGAGCGTACTTTGTCATTGCG
JMFF005E15+ AGCCCCCCGGCCACGGGGTGACAAACTTCTTGGAGTTGGAGAGCGTACTTTGTCATTGCG
                      ____________________________________________________________
consensus AGCCCCCCGGCCACGGGGTGACAAACTTCTTGGAGTTGGAGAGCGTACTTTGTCATTGCG
 
. : . : . : . : . : . :
JMFN039H10+ TCCATCTGGACTGCCATCCCTAGATTGAGGGGTTCTGCGAGGAGATGGACTCCTCCTTGG
JMFF005E15+ TCCATCTGGACTGCCATCCCTAGATTGAGGGGTTCTGCGAGGAGATGGACTCCTCCTTGG
                      ____________________________________________________________
consensus TCCATCTGGACTGCCATCCCTAGATTGAGGGGTTCTGCGAGGAGATGGACTCCTCCTTGG
 
. : . : . : . : . : . :
JMFN039H10+ ACTTGGGCTACCATCCCTAGGTTGAGGGGTTCTGCGAGGAGATGGACTCCTCGTTGGACT
JMFF005E15+ ACTTGGGCTACCATCCCTAGGTTGAGGGGTTCTGCGAGGAGATGGACTCCTCGTTGGACT
                      ____________________________________________________________
consensus ACTTGGGCTACCATCCCTAGGTTGAGGGGTTCTGCGAGGAGATGGACTCCTCGTTGGACT
 
. : . : . : . : . : . :
JMFN039H10+ TGGGCTACGCCGAGCAGGAGAGGCACTTCCATAGGAACGACTTCGGCTACGCCTCTCATC
JMFF005E15+ TGGGCTACGCCGAGCAGGAGAGGCACTTCCATAGGAACGACTTCGGCTACGCCTCTCATC
                      ____________________________________________________________
consensus TGGGCTACGCCGAGCAGGAGAGGCACTTCCATAGGAACGACTTCGGCTACGCCTCTCATC
 
. : . : . : . : . : . :
JMFN039H10+ ATCATATCTACCTCTACCACGATCTTT
JMFF005E15+ ATCATATCTACCTCTACCACGATCTTTATGGTAATCAGGGCTTCCACTGCGGCTTCTGTA
                      ____________________________________________________________
consensus ATCATATCTACCTCTACCACGATCTTTATGGTAATCAGGGCTTCCACTGCGGCTTCTGTA
 
. : . : . : . : . : . :
JMFF005E15+ CCGATGACGATCTCTATCCCTGCCACGGTATCGATCATGCTCAGATCTACCCCGACTTCT
                      ____________________________________________________________
consensus CCGATGACGATCTCTATCCCTGCCACGGTATCGATCATGCTCAGATCTACCCCGACTTCT
 
. : . : . : . : . : . :
JMFF005E15+ ACTCCTGCTCCTCTTTAATAATCTCTATCTCTATGATCATCTCTATACCTTGATCTAGGA
                      ____________________________________________________________
consensus ACTCCTGCTCCTCTTTAATAATCTCTATCTCTATGATCATCTCTATACCTTGATCTAGGA