Previous Contig 000252:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E03Sequence442000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.402000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFF016F20Sequence410000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.375000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFN014N02Sequence430000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFN034O17Sequence410000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFN038I07Sequence420000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMSF031I23Sequence449000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.399000252 (9)gb:AC092781_17357472e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038I07+ AAAAGAT
JMFN034O17+ TTTAAAAGAT
JMFF005E03+ TTTTTTTTTTCTTTTAAAAGAT
                      ____________________________________________________________
consensus TTTTTTTTTTCTTTTAAAAGAT
 
. : . : . : . : . : . :
JMFN038I07+ GGGAGAAAACATATCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
JMFF016F20+ TCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
rJMSF031I23- ACATATCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
rJMFF005E03- AAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
JMFN034O17+ GGGAGAAAAAATATCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
rJMFF016F20- AGATAACAGCTAGTTTGATAA
JMFF005E03+ GGGAGAAAACATATCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
                      ____________________________________________________________
consensus GGGAGAAAACATATCACAAAGTTCAACAATCTTTAAACAAGATAACAGCTAGTTTGATAA
 
. : . : . : . : . : . :
JMFN038I07+ TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
JMFF016F20+ TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
rJMSF031I23- TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
rJMFF005E03- TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
JMFN034O17+ TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
rJMFF016F20- TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
JMFF005E03+ TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
                      ____________________________________________________________
consensus TATGGAAAAACAAAACCATTAAATATCAGATATTATAATCTGTTCTTAAGGCAACTACAT
 
. : . : . : . : . : . :
JMFN038I07+ ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
JMFF016F20+ ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
rJMSF031I23- ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
rJMFF005E03- ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
JMFN034O17+ ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
rJMFF016F20- ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
JMSF031I23+ AGCG
JMFN014N02+ AGCG
JMFF005E03+ ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
                      ____________________________________________________________
consensus ATTGATCAAATATCAAATTGTTCTTGTTCTTGATTGCAAGGGTCTCTGGATTCTTCAGCG
 
. : . : . : . : . : . :
JMFN038I07+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
JMFF016F20+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
rJMSF031I23- GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
rJMFF005E03- GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
JMFN034O17+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
rJMFF016F20- GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
JMSF031I23+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
JMFN014N02+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
JMFF005E03+ GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
                      ____________________________________________________________
consensus GTACTTGATGAATCCGATTTCCTTGGCGTTGCTTCGGAAGCACTGTCTGCAGCACATAAG
 
. : . : . : . : . : . :
JMFN038I07+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
JMFF016F20+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
rJMSF031I23- CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
rJMFF005E03- CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
JMFN034O17+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
rJMFF016F20- CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
JMSF031I23+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
JMFN014N02+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
JMFF005E03+ CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
                      ____________________________________________________________
consensus CCCATACTTTCTGATAATTCCATGAGAATTACCACAGACACGGCATGCGCGCGAGCCGGG
 
. : . : . : . : . : . :
JMFN038I07+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
JMFF016F20+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
rJMSF031I23- CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
rJMFF005E03- CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
JMFN034O17+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
rJMFF016F20- CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
JMSF031I23+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
JMFN014N02+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
JMFF005E03+ CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
                      ____________________________________________________________
consensus CCCGTAGTTCTTGGGGTGAGCGTTCCAGATGTTAGAGTGTCCCATTGTTCTCTCTTCCTC
 
. : . : . : . : . : . :
JMFN038I07+ GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATC
JMFF016F20+ GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATCT
rJMSF031I23- GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTA
rJMFF005E03- GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATCT
JMFN034O17+ GTTGAGGCTTCGACCACAGAGCAGCTGC
rJMFF016F20- GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATCT
JMSF031I23+ GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTA
JMFN014N02+ GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAA
JMFF005E03+ GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATCTGGGGAG
                      ____________________________________________________________
consensus GTTGAGGCTTCGACCACAGAGCAGCTGCGAGAAAACCCTAACGCTTAAGAATCTGGGGAG