Previous Contig 000248:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005D04Sequence470000248 (2)gb:AP005429_18516961e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P070743008635 (6)pir|T50802|T508022e-68serine/threonine protein kinase-like protein - Arabidopsis thaliana>gb:ATT30N20_
JMFF018A01Sequence613000248 (2)gb:AF448226_18006411e-25Arabidopsis thaliana CBL-interacting protein kinase CIPK25 mRNA, complete cds.628008635 (6)pir|T50802|T508027e-56serine/threonine protein kinase-like protein - Arabidopsis thaliana>gb:ATT30N20_

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018A01+ TGTGCTTGGTAGC
                      ____________________________________________________________
consensus TGTGCTTGGTAGC
 
. : . : . : . : . : . :
JMFF018A01+ CATGACTTCTTTGAGCTCCACGATGTTTGGGTGCTTCACCAATCGCATGACTGAGATTTC
                      ____________________________________________________________
consensus CATGACTTCTTTGAGCTCCACGATGTTTGGGTGCTTCACCAATCGCATGACTGAGATTTC
 
. : . : . : . : . : . :
JMFF018A01+ CCGCTGGATTTGCTCCATCATGGCCTCTTTCTTCGCCACATGGTCTTTGTGGATAACCTT
                      ____________________________________________________________
consensus CCGCTGGATTTGCTCCATCATGGCCTCTTTCTTCGCCACATGGTCTTTGTGGATAACCTT
 
. : . : . : . : . : . :
JMFF018A01+ GATGGCCACGCTCTCGGAGGTTTCCAGGTTTCTGCCGTAGTACACCTTGGCGAAGGTTCC
JMFF005D04+ CTCTCGGAGGTTTCCAGGTTTCTGCCGTAGTACACCTTGGCGAAGGTTCC
                      ____________________________________________________________
consensus GATGGCCACGCTCTCGGAGGTTTCCAGGTTTCTGCCGTAGTACACCTTGGCGAAGGTTCC
 
. : . : . : . : . : . :
JMFF018A01+ TTGACCCAGCAGCCTCCCCATCTCGTACTTCCCGAAATAATACCCCGACACGCTCCATTG
JMFF005D04+ TTGACCCAGCAGCCTCCCCATCTCGTACTTCCCGAAATAATACCCCGACACGCTCCATTG
                      ____________________________________________________________
consensus TTGACCCAGCAGCCTCCCCATCTCGTACTTCCCGAAATAATACCCCGACACGCTCCATTG
 
. : . : . : . : . : . :
JMFF018A01+ AAAAGGTGGTGTTCAGATTGGGTTTCCATGGTGATATCCACTATTCAAGGCACTTACAAA
JMFF005D04+ AAAAGGTGGTGTTCAGATTGGGTTTCCATGGTGATATCCACTATTCAAGGCACTTACAAA
                      ____________________________________________________________
consensus AAAAGGTGGTGTTCAGATTGGGTTTCCATGGTGATATCCACTATTCAAGGCACTTACAAA
 
. : . : . : . : . : . :
JMFF018A01+ ATCATTATATTGTGTTTGGGGCGGTTATCATGGTAGTAGTTGAATTGAGACGAAAAGTAA
JMFF005D04+ ATCATTATATTGTGTTTGGGGCGGTTATCATGGTAGTAGTTGAATTGAGACGAAAAGTAA
                      ____________________________________________________________
consensus ATCATTATATTGTGTTTGGGGCGGTTATCATGGTAGTAGTTGAATTGAGACGAAAAGTAA
 
. : . : . : . : . : . :
JMFF018A01+ AGTGGGTTTGGAGAGTAGAAAACAATGATTTCGGTCGGGAAATTGGGTGGTGGTGGTGGC
JMFF005D04+ AGTGGGTTTGGAGAGTAGAAAACAATGATTTCGGTCGGGAAATTGGGTGGTGGTGGTGGC
                      ____________________________________________________________
consensus AGTGGGTTTGGAGAGTAGAAAACAATGATTTCGGTCGGGAAATTGGGTGGTGGTGGTGGC
 
. : . : . : . : . : . :
JMFF018A01+ GGCGGTGGTGGTGGAGGGGTTGTAAGGTGGGTGTGGCTAAAAATTTGAGCTTTAAAGGAT
JMFF005D04+ GGCGGTGGTGGTGGAGGGGTTGTAAGGTGGGTGTGGCTAAAAATTTGAGCTTTAAAGGAT
                      ____________________________________________________________
consensus GGCGGTGGTGGTGGAGGGGTTGTAAGGTGGGTGTGGCTAAAAATTTGAGCTTTAAAGGAT
 
. : . : . : . : . : . :
JMFF018A01+ GGGAATTGAAATGAATTGAATTGGACATAAAAGGGTGAGAAAGAGATAGTGCGTTGGATG
JMFF005D04+ GGGAATTGAAATGAATTGAATTGGACATAAAAGGGTGAGAAAGAGATAGTGCGTTGGATG
                      ____________________________________________________________
consensus GGGAATTGAAATGAATTGAATTGGACATAAAAGGGTGAGAAAGAGATAGTGCGTTGGATG
 
. : . : . : . : . : . :
JMFF018A01+ TTTGCTAGTGAAAGGAGGACGTGGTTTTTCTAGTGTGGAGACAGTGGGAGTGAGGCAAGC
JMFF005D04+ TTTGCTAGTGAAAGGAGGACGTGGTTTTTCTAGTGTGGAGACAGTGGGAGTGAGGCAAGC
                      ____________________________________________________________
consensus TTTGCTAGTGAAAGGAGGACGTGGTTTTTCTAGTGTGGAGACAGTGGGAGTGAGGCAAGC