Previous Contig 000247:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004B21Sequence563000247 (13)gb:AY632359_16187003e-46Gossypium hirsutum BAC 155C17, complete sequence.764000247 (13)gb:AY632360_16187149e-41Gossypium hirsutum BAC 106I22, complete sequence.
JMFF005D03Sequence497000247 (13)gb:AY632360_16187143e-05Gossypium hirsutum BAC 106I22, complete sequence.744000247 (13)gb:AY632360_16187146e-58Gossypium hirsutum BAC 106I22, complete sequence.
JMFF019F03Sequence614000247 (13)gb:AY632359_16187002e-09Gossypium hirsutum BAC 155C17, complete sequence.548000247 (13)gb:AY632359_16187001e-13Gossypium hirsutum BAC 155C17, complete sequence.
JMFF028N07Sequence580000247 (13)gb:AY632360_16187142e-09Gossypium hirsutum BAC 106I22, complete sequence.
JMFF036N12Sequence591000247 (13)gb:AY632360_16187141e-09Gossypium hirsutum BAC 106I22, complete sequence.769000247 (13)gb:AY632360_16187144e-59Gossypium hirsutum BAC 106I22, complete sequence.
JMFF038A08Sequence494000247 (13)gb:AY632360_16187149e-05Gossypium hirsutum BAC 106I22, complete sequence.682000247 (13)gb:AY632360_16187148e-51Gossypium hirsutum BAC 106I22, complete sequence.
JMSF005L23Sequence303000247 (13)373000247 (13)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF004B21- TCGATGATTA
                      ____________________________________________________________
consensus TCGATGATTA
 
. : . : . : . : . : . :
rJMFF019F03- TTGGTATTAACTCCACTCNNGATTAAACTANAGTCNTACTCNNAATCTTCTACATTC
rJMFF004B21- AACTTGGTATTAACTCCACTCAAGATTAAACTAAAGTCATACTCAAAATCTTCTACATTC
                      ____________________________________________________________
consensus AACTTGGTATTAACTCCACTCAAGATTAAACTAAAGTCATACTCAAAATCTTCTACATTC
 
. : . : . : . : . : . :
rJMFF019F03- AAAACANAAGATACATTANNAGCTAGGAGGAAGAGTTTCAAAGATCACATTTATGTATTT
rJMSF005L23- AAACAGAAGANACATTAGAAGCTAGGAGGAAGAGTTTCGAAGATCACNTTTATGTATTT
rJMFF004B21- AAAACAGAAGATACATTAAAAGCTAGGAGGAAGAGTTTCGAAGATCACATTTATGTATTT
rJMFF036N12- TTTATGTATTT
                      ____________________________________________________________
consensus AAAACAGAAGATACATTAGAAGCTAGGAGGAAGAGTTTCGAAGATCACATTTATGTATTT
 
. : . : . : . : . : . :
rJMFF019F03- CACTTCANAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
rJMSF005L23- CACTTCNAAACCTTTCACATATGACTGACAATATGTACATCNCATTTCCAGGCACTAATC
rJMFF004B21- CACTTCAAAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
rJMFF038A08- AAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
rJMFF005D03- AAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
rJMFF036N12- CACTTC-AAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
                      ____________________________________________________________
consensus CACTTCAAAACCTTTCACATATGACTGACAATATGTACATCTCATTTCCAGGCACTAATC
 
. : . : . : . : . : . :
rJMFF019F03- ATAAGATAAGGATTGNTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
rJMSF005L23- ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
rJMFF004B21- ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
rJMFF038A08- ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
rJMFF005D03- ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
rJMFF036N12- ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
                      ____________________________________________________________
consensus ATAAGATAAGGATTGTTATGTTGGGATGTTTGAAGTGTGTCTTCTGAATACATACATTGG
 
. : . : . : . : . : . :
rJMFF019F03- TGCANAATTGAATTGTNANGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
rJMSF005L23- TGCAGAATTGAATTGTCAAGATCTTCTATCCNACTTCTTGNCACTAGATCGCTTCTCTTC
rJMFF004B21- TGCAGAATTGAATTGTCAAGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
rJMFF038A08- TGCAGAATTGAATTGTCAAGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
rJMFF005D03- TGCAGAATTGAATTGTCAAGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
rJMFF036N12- TGCAGAATTGAATTGTCAAGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
                      ____________________________________________________________
consensus TGCAGAATTGAATTGTCAAGATCTTCTATCCAACTTCTTGTCACTAGATCGCTTCTCTTC
 
. : . : . : . : . : . :
rJMFF019F03- TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCANCATTAGCANCAGA
rJMSF005L23- TGCTTCCTTCCGTTTTTGTTGCGCANAAGCAGCNTATCCACTACCAGCATTANCAGCAGA
rJMFF004B21- TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCAGCATTAGCAGCAGA
rJMFF038A08- TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCAGCATTAGCAGCAGA
rJMFF005D03- TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCAGCATTAGCAGCAGA
rJMFF036N12- TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCAGCATTAGCAGCAGA
                      ____________________________________________________________
consensus TGCTTCCTTCCGTTTTTGTTGCGCAAAAGCAGCATATCCACTACCAGCATTAGCAGCAGA
 
. : . : . : . : . : . :
rJMFF019F03- TAACAGTGCTGCATGTGCACCAACANCANATATTGTATCCCTACGATCAACATCCACCTT
rJMSF005L23- TAACAGTGCTGCATGTGCACCAACAGNANATATTGTATCCCTACGATCAACATCCACC
rJMFF004B21- TAACAGTGCTGCATGTGCACCAACAGCAGATATTGTATCCCTACGATCAACATCCACCTT
rJMFF038A08- TAACAGTGCTGCATGTGCACCAACAGCAGATATTGTATCCCTACGATCAACATCCACCTT
rJMFF005D03- TAACAGTGCTGCATGTGCACCAACAGCAGATATTGTATCCCTACGATCAACATCCACCTT
rJMFF036N12- TAACAGTGCTGCATGTGCACCAACAGCAGATATTGTATCCCTACGATCAACATCCACCTT
                      ____________________________________________________________
consensus TAACAGTGCTGCATGTGCACCAACAGCAGATATTGTATCCCTACGATCAACATCCACCTT
 
. : . : . : . : . : . :
rJMFF019F03- ATCCCACTTAGACTTTTTGNTCTGTCTGCTGTCCCGAGGTATANCATCCACAGAAGTNGG
rJMFF004B21- ATCCCACTTAGACTTTTTGTTCTGTCTGCTGTCCCGAGGTATAGCATCCACAGAAGTTGG
rJMFF038A08- ATCCCACTTAGACTTTTTGTTCTGTCTGCTGTCCCGAGGTATAGCATCCACAGAAGTTGG
rJMFF005D03- ATCCCACTTAGACTTTTTGTTCTGTCTGCTGTCCCGAGGTATAGCATCCACAGAAGTTGG
rJMFF036N12- ATCCCACTTAGACTTTTTGTTCTGTCTGCTGTCCCGAGGTATAGCATCCACAGAAGTTGG
                      ____________________________________________________________
consensus ATCCCACTTAGACTTTTTGTTCTGTCTGCTGTCCCGAGGTATAGCATCCACAGAAGTTGG
 
. : . : . : . : . : . :
rJMFF019F03- NGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGNCAGATTGGGTTTCTGCAT
rJMFF004B21- TGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGGCAGATTGGGTTTCTGCAT
rJMFF038A08- TGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGGCAGATTGGGTTTCTGCAT
rJMFF005D03- TGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGGCAGATTGGGTTTCTGCAT
rJMFF036N12- TGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGGCAGATTGGGTTTCTGCAT
                      ____________________________________________________________
consensus TGCTGCACTCAATCCACTACCAGCAACAAGACCTGGAATTGGCAGATTGGGTTTCTGCAT
 
. : . : . : . : . : . :
rJMFF019F03- ANTAACAACAG
rJMFF004B21- AGTAACAACAGCACCAGGCTGTGTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
rJMFF038A08- AGTAACAACAGCACCAGGCTGTGTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
rJMFF005D03- AGTAACAACAGCACCAGGCTGTGTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
rJMFF036N12- AGTAACAACAGCACCAGGCTGTGTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
JMFF004B21+ GTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
                      ____________________________________________________________
consensus AGTAACAACAGCACCAGGCTGTGTTCCTCCAGAAATGAAGTCAACTTTTTGACTGTTCCG
 
. : . : . : . : . : . :
rJMFF004B21- CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
rJMFF038A08- CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
rJMFF005D03- CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
rJMFF036N12- CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
JMFF004B21+ CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
                      ____________________________________________________________
consensus CCTTTCTTGTTCCTTCCTCTCCATTTCACGCCTCATATCAGCCTCTATTTCATCATAGAA
 
. : . : . : . : . : . :
rJMFF004B21- GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
rJMFF038A08- GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
rJMFF005D03- GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
rJMFF036N12- GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
JMFF004B21+ GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
                      ____________________________________________________________
consensus GTCAGATTTATCATATCCATGTGGGTCAAATACATCAATACTGAAGCAGGACCCTATCTC
 
. : . : . : . : . : . :
rJMFF004B21- ATCAATGCCTTGATATTGCACCGCATGCCGCAAG
rJMFF038A08- ATCAATGCCTTGATATTGCACCGCATGCCGCAAGAAATCANGGTTTCTATAGTCCTTTCT
rJMFF005D03- ATCAATGCCTTGATATTGCACCGCATGCCGCAAGAAATCAGGGTTTCTATAGTCCTTTCT
rJMFF036N12- ATCAATGCCTTGATATTGCACCGCATGCCGCAAGAAATCAGGGTTTCTATAGTCCTTTCT
JMFF004B21+ ATCAATGCCTTGATATTGCACCGCATGCCGCAAGAAATCAGGGTTTCTATAGTCCTTTCT
                      ____________________________________________________________
consensus ATCAATGCCTTGATATTGCACCGCATGCCGCAAGAAATCAGGGTTTCTATAGTCCTTTCT
 
. : . : . : . : . : . :
rJMFF038A08- ATTTCGCACTTCTGCATTAAAGCTTCTGC
rJMFF005D03- ATTTCGCACTTCTGCATTAAAGCTTCTGCCAGTCGTTTTCTTTAGTGCAAGAAACTTAAT
rJMFF036N12- ATTTCGCACTTCTGCATTAAAGCTTCTGCCAGTCGTTTTCTTTAGTGCAAGAAACTTAAT
JMFF004B21+ ATTTCGCACTTCTGCATTAAAGCTTCTGCCAGTCGTTTTCTTTAGTGCAAGAAACTTAAT
                      ____________________________________________________________
consensus ATTTCGCACTTCTGCATTAAAGCTTCTGCCAGTCGTTTTCTTTAGTGCAAGAAACTTAAT
 
. : . : . : . : . : . :
rJMFF005D03- AATCTTTTCTTGTAATTCATCTGAGCA
rJMFF036N12- AATCTTTTCTTGTAATTCATCTGAGCACTTGGCCTTA
JMFF004B21+ AATCTTTTCTTGTAATTCATCTGAGCACTTGGCCTTAGGTGGTGGTGGAAGAAACTTATC
                      ____________________________________________________________
consensus AATCTTTTCTTGTAATTCATCTGAGCACTTGGCCTTAGGTGGTGGTGGAAGAAACTTATC
 
. : . : . : . : . : . :
JMFF004B21+ TAGTTGATCTTCCTCTTTTTCTTCTGCAGGAACCATATCAACATCTTCAGAACCCAAAGT
                      ____________________________________________________________
consensus TAGTTGATCTTCCTCTTTTTCTTCTGCAGGAACCATATCAACATCTTCAGAACCCAAAGT
 
. : . : . : . : . : . :
JMFF004B21+ ATTTCCTTCATCAGCACTTGTCTCTAATGATTGAGTTTGAGGTGTTTGACGACTTGGTGT
JMFF019F03+ GACTTGGTGT
                      ____________________________________________________________
consensus ATTTCCTTCATCAGCACTTGTCTCTAATGATTGAGTTTGAGGTGTTTGACGACTTGGTGT
 
. : . : . : . : . : . :
JMFF004B21+ ATGGCCCCGAAGAGTGCCCGGTGGACTTTTAACTTGTGATTCAGCGTTAACAGTTTGTAG
JMFF036N12+ AAGAGTGCCCGGTGGACTTTTAACTTGTGATTCAGCGTTAACAGTTNGTAG
JMFF028N07+ GTGGACTTTTAACTTGTGATTCAGCGTTAACAGTTTGTAG
JMFF019F03+ ATGNCCCCGAAGAGTGCCCGGTGGACTTTTAACTTGTGATTCAGCGTTAACAGTTNGTAG
                      ____________________________________________________________
consensus ATGGCCCCGAAGAGTGCCCGGTGGACTTTTAACTTGTGATTCAGCGTTAACAGTTTGTAG
 
. : . : . : . : . : . :
JMFF004B21+ TTCCTATGCATCCTGTGATTGACCACTAATCATGATTTCTCCT
JMFF036N12+ TTCCTCTGCATCCTGTGATTGACCACTAATCATGATTTCTCCTTCCTCAGCTTCAGGAGA
JMFF028N07+ TTCCTCTGCATCCTGTGATTGACCACTAATCATGATTTCTCCTTCCTCAGCTTCAGGAGA
JMFF019F03+ TTCCTCTGCATCCTGTGATTGACCACTAATCATGATTTCTCCTTCCTCAGCTTCAGGAGA
JMFF038A08+ TCAGCTTCAGGAGA
JMFF005D03+ TCCTCAGCTTCAGGAGA
                      ____________________________________________________________
consensus TTCCTCTGCATCCTGTGATTGACCACTAATCATGATTTCTCCTTCCTCAGCTTCAGGAGA
 
. : . : . : . : . : . :
JMFF036N12+ CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAGCCGC
JMFF028N07+ CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAGCCGC
JMFF019F03+ CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAACCGC
JMFF038A08+ CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAGCCGC
JMFF005D03+ CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAGCCGC
                      ____________________________________________________________
consensus CATGGCGACCTCATCGTGGGCGTAATCAACTATCGTAAGTCTACTTCTACTCACAGCCGC
 
. : . : . : . : . : . :
JMFF036N12+ CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
JMFF028N07+ CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
JMFF019F03+ CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
JMFF038A08+ CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
JMFF005D03+ CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
                      ____________________________________________________________
consensus CTCGGAAGCAACACCTTGTTGTTGCCACTGCGGCGGGGAAGCGAAAGAGAGGTGCGGTGT
 
. : . : . : . : . : . :
JMFF036N12+ GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
JMFF028N07+ GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
JMFF019F03+ GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
JMFF038A08+ GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
JMSF005L23+ AC
JMFF005D03+ GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
                      ____________________________________________________________
consensus GGTAGTAGCAGAACCCCCAAAATTTGAAATCTTACCAGGCGTAAGATTGTCCACTCCCAC
 
. : . : . : . : . : . :
JMFF036N12+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
JMFF028N07+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
JMFF019F03+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
JMFF038A08+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
JMSF005L23+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
JMFF005D03+ GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
                      ____________________________________________________________
consensus GCGCCGCTTCTGCTGCTGCTGCTGCCGTCGTGCTAACGGGGATGGAGATGCACTCTTACC
 
. : . : . : . : . : . :
JMFF036N12+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
JMFF028N07+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
JMFF019F03+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
JMFF038A08+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
JMSF005L23+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
JMFF005D03+ CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
                      ____________________________________________________________
consensus CGAATCCGAGTCAATATCGTCATCTTCGCCGAGCTCGTTCTCCGCTGCGTCGTTTTGGAT
 
. : . : . : . : . : . :
JMFF036N12+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
JMFF028N07+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
JMFF019F03+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
JMFF038A08+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
JMSF005L23+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
JMFF005D03+ CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
                      ____________________________________________________________
consensus CTGCTCCTCATCTTCGTCGCTTTCATCCTCTATGTAATCATCCATCTCGTCGTCGTCCTC
 
. : . : . : . : . : . :
JMFF036N12+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
JMFF028N07+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
JMFF019F03+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
JMFF038A08+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
JMSF005L23+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
JMFF005D03+ GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
                      ____________________________________________________________
consensus GTCGCCATAGATGGAAAGCAAAGCAATGCCCTCTGATTCCTTCTTCTTGGGAGCCATGTC
 
. : . : . : . : . : . :
JMFF036N12+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC
JMFF028N07+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC
JMFF019F03+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC
JMFF038A08+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC
JMSF005L23+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTA
JMFF005D03+ GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC
                      ____________________________________________________________
consensus GGAGATTGAAGATTGGGTAAGAAGATTCGATCGAAGAAGACTAAGGGGTTTACACAGTAC