Previous Contig 000238:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005A14Sequence409000238 (12)pir|T49142|T491421e-21CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217729000238 (12)pir|T49142|T491426e-87CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFF013F24Sequence548000238 (12)pir|T49142|T491427e-45CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217667000238 (12)pir|T49142|T491429e-81CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFF028P11Sequence494000238 (12)pir|T49142|T491421e-38CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217375000238 (12)pir|T49142|T491423e-52CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFF030M22Sequence512000238 (12)pir|T49142|T491426e-42CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217710000238 (12)pir|T49142|T491423e-94CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFF048C14Sequence292000238 (12)pir|T49142|T491427e-13CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217251000238 (12)pir|T49142|T491426e-25CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFN006A18Sequence618000238 (12)pir|T49142|T491425e-61CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217
JMFN029M19Sequence638000238 (12)pir|T49142|T491423e-85CCR4-associated factor 1-like protein - Arabidopsis thaliana>gb:ATT10D17_1554217

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048C14- GTTTAACTAAAAGAATTAATAAAATTATTATTTTTTGTTTA
JMFN029M19+ TTTTTGTTNA
rJMFF005A14- TTTTTGTTTA
                      ____________________________________________________________
consensus GTTTAACTAAAAGAATTAATAAAATTATTATTTTTTGTTTA
 
. : . : . : . : . : . :
rJMFF048C14- ACAATTAGAATTATCTTAAAAAACTTCTAGTCCATACAATACTCCGGCATGTTTTTCCGG
JMFN029M19+ ACAATTAGAATTATCTTAAAAAACTTNTAGTCCATACAATACTCCGGCATGTTTTTCCGG
rJMFF028P11- ACTTCTAGTCCATACAATACTCCGGCATGTTTTTCCGG
rJMFF005A14- ACAATTAGAATTATCTTAAAAAACTTCTAGTCCATACAATACTCCGGCATGTTTTTCCGG
rJMFF013F24- ATACTCCGGNATGTTTTTCCGG
rJMFF030M22- AACTTCTAGTCCATACAATACTCCGGCATGTTTTTCCGG
                      ____________________________________________________________
consensus ACAATTAGAATTATCTTAAAAAACTTCTAGTCCATACAATACTCCGGCATGTTTTTCCGG
 
. : . : . : . : . : . :
rJMFF048C14- TCCTTCATTTACAAAGTACACATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
JMFN029M19+ TCCTTCATTTACAAAGTACACATCCCTCATTTTTNGAAACGTGTGCCATGTCAGCAGGCT
rJMFF028P11- TCCTTCATTTACAAAGTACACATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
rJMFF005A14- TCCTTCATTTACAAAGTACACATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
rJMFF013F24- TCCTTCATTTAC-AAGTACNCATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
rJMFF030M22- TCCTTCATTTACAAAGTACACATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
                      ____________________________________________________________
consensus TCCTTCATTTACAAAGTACACATCCCTCATTTTTTGAAACGTGTGCCATGTCAGCAGGCT
 
. : . : . : . : . : . :
rJMFF048C14- ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
JMFN029M19+ ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
rJMFF028P11- ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
rJMFF005A14- ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
rJMFF013F24- ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
rJMFF030M22- ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
                      ____________________________________________________________
consensus ATCTGAACCGGCCTGATGGCATTTTCCGACCACCCGGTCCACGGCCAGCGTTCTGGCCAA
 
. : . : . : . : . : . :
rJMFF048C14- CCGGTCTAGCCCGCCATAAAGACTCTGGCA
JMFN029M19+ CCGGTCTAGCCCGCCATAGAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
rJMFF028P11- CCGGTCTAGCCCGCCATAGAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
rJMFF005A14- CCGGTCTAGCCCGCCATAGAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
rJMFF013F24- CCGGTCTAGCCCGCCATANAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
rJMFF030M22- CCGGTCTAGCCCGCCATAGAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
                      ____________________________________________________________
consensus CCGGTCTAGCCCGCCATAGAGACTCTGGCAGAACTTCATGAGGTGCTTGATGTCATAAAC
 
. : . : . : . : . : . :
JMFN029M19+ CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
rJMFF028P11- CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
rJMFF005A14- CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
rJMFF013F24- CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
rJMFF030M22- CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
                      ____________________________________________________________
consensus CCTATCCCCGAAGAAGATCTTGAGAATTTCCAAGAAATCTTCCAGATCTCCGGGCAAGGA
 
. : . : . : . : . : . :
JMFN029M19+ GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCGTACGCGCTGTGGAACGTGACCCA
rJMFF028P11- GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCNTACGCGCTGTGGAACNTGACCCA
rJMFF005A14- GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCGTACGCGCTGTGGAACGTGACCCA
rJMFF013F24- GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCGTACGCGCTGTGGAACGTGACCCA
rJMFF030M22- GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCGTACGCGCTGTGGAACGTGACCCA
JMFN006A18+ GCCGAAATCGTACGCGCTGTGGAACGTGACCCA
                      ____________________________________________________________
consensus GCGGCGCGTGAGGATCTTGACCAGGTAGCCGAAATCGTACGCGCTGTGGAACGTGACCCA
 
. : . : . : . : . : . :
JMFN029M19+ GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
rJMFF028P11- GCTGACGGACTCGTTACAGACCNGGCCGGACGACATC
rJMFF005A14- GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
rJMFF013F24- GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
rJMFF030M22- GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
JMFN006A18+ GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
JMFF013F24+ CGAACCGGGCGGA
                      ____________________________________________________________
consensus GCTGACGGACTCGTTACAGACCAGGCCGGACGACATCATCAACTCGGCGAACCGGGCCGA
 
. : . : . : . : . : . :
JMFN029M19+ GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
rJMFF005A14- GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
rJMFF013F24- GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
rJMFF030M22- GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
JMFN006A18+ GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
JMFF013F24+ GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
JMFF030M22+ TGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
JMFF028P11+ GACGGCGGAGCAACTCGAC
                      ____________________________________________________________
consensus GTCAACCCCGCAGTCCCGGTTCTTGTCGAAGTCGATTCCCTGACGGCGGAGCAACTCGAC
 
. : . : . : . : . : . :
JMFN029M19+ GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
rJMFF005A14- GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
rJMFF013F24- GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
rJMFF030M22- GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
JMFN006A18+ GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
JMFF013F24+ GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
JMFF030M22+ GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
JMFF028P11+ GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
                      ____________________________________________________________
consensus GGAATCCGGCGCGTAGAGGTCACGCTGCACGTCAAAGTCGGAGAAATTGAACTGCCAGAT
 
. : . : . : . : . : . :
JMFN029M19+ GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
rJMFF005A14- GAAGCGGTGGCCGTCAGATCCGAGCCACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
rJMFF013F24- GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
rJMFF030M22- GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
JMFN006A18+ GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
JMFF013F24+ GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
JMFF030M22+ GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
JMFF028P11+ GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
JMFF005A14+ CCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
                      ____________________________________________________________
consensus GAAGCGGTGGCCGTCAGATCCGAG-CACGGGGAGGTTTCCGCTACCGTCCGACAAAGTCA
 
. : . : . : . : . : . :
JMFN029M19+ ACCCCAA-CTGAATCAGATTCAG
rJMFF005A14- ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTANGAATCC
rJMFF013F24- ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
rJMFF030M22- ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
JMFN006A18+ ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
JMFF013F24+ ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
JMFF030M22+ ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
JMFF028P11+ ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
JMFF005A14+ ACCCCAACCTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
                      ____________________________________________________________
consensus ACCCCAA-CTGAATCAGATTCAGAGCATCCACGTTTGACTTGAGCAACCGGTAGGAATCC
 
. : . : . : . : . : . :
rJMFF005A14- GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGA
rJMFF013F24- GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGG
rJMFF030M22- GCAGAGCGATCGGAAGCCGAGAAAGGNCCTCGCCGGCGACTCTCCGGCTTGAAAACNACC
JMFN006A18+ GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
JMFF013F24+ GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
JMFF030M22+ GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
JMFF028P11+ GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
JMFF048C14+ CGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
JMFF005A14+ GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
                      ____________________________________________________________
consensus GCAGAGCGATCGGAAGCCGAGAAAGGCCCTCGCCGGCGACTCTCCGGCTTGAAAACAACC
 
. : . : . : . : . : . :
rJMFF030M22- CCAGGAAACTCCG
JMFN006A18+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
JMFF013F24+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
JMFF030M22+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
JMFF028P11+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
JMFF048C14+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
JMFF005A14+ CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
                      ____________________________________________________________
consensus CCAGGAAACTCCGTATCCATGGAGATGTACGGATACTCGTCGATGAGGTGGCTGATGAGC
 
. : . : . : . : . : . :
JMFN006A18+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
JMFF013F24+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
JMFF030M22+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
JMFF028P11+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
JMFF048C14+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
JMFF005A14+ TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
                      ____________________________________________________________
consensus TGGAACTCCGATTCCAGATTATCCGCCCAAACTTCCCGAATCTTAATGGGATTTGCGTCC
 
. : . : . : . : . : . :
JMFN006A18+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
JMFF013F24+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
JMFF030M22+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
JMFF028P11+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
JMFF048C14+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
JMFF005A14+ AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
                      ____________________________________________________________
consensus AAAACATCTTCTTGTACCCCCATAACCTTAAACCTTAAAAAAACCAAACAAATAAAAACT
 
. : . : . : . : . : . :
JMFN006A18+ GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGAT
JMFF013F24+ GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGATGAATATG
JMFF030M22+ GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGATGAATATGG
JMFF028P11+ GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGATGAATATGG
JMFF048C14+ GAAACTTGCAGAAACCCTTTAAAGCTATCGGATCAAAGAACACAGATGAATATGG
JMFF005A14+ GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGATGAATATGGATGAT
                      ____________________________________________________________
consensus GAAACTTGCAGAAACCCTTTAAAGCTATCAGATCAAAGAACACAGATGAATATGGATGAT