Previous Contig 000233:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O10Sequence485000233 (6)gb:AF200322_17764544e-37Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-724000233 (6)gb:AF200322_17764549e-37Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-
JMFN011C10Sequence563000233 (6)gb:AB007819_15103244e-15Citrus unshiu gene for glycine-rich RNA-binding protein, complete cds.
JMFN037J14Sequence534000233 (6)gb:AF009003_17610624e-04Pelargonium x hortorum glycine-rich RNA binding protein 1 (GRP1) mRNA, complete
JMSF028M15Sequence687000233 (6)gb:AF200322_17764548e-37Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-724000233 (6)gb:AF200322_17764549e-37Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037J14+ AGCGCAAATCTCCATTATTTAATTCCATGGAACAACGTTAATACAGATTTACAATATAAC
JMFN011C10+ ACAACGTTAATACAGATTTACAATATAAC
rJMSF028M15- ATACAGATTTACAATATAAC
                      ____________________________________________________________
consensus AGCGCAAATCTCCATTATTTAATTCCATGGAACAACGTTAATACAGATTTACAATATAAC
 
. : . : . : . : . : . :
JMFN037J14+ AGCAGCGATCAATATAGAAAGTGACACAGTCGAATACATCGCACGGAGAACCCATAACCA
JMFN011C10+ AGCAGCGATCAATATAGAAAGTGACACAGTCGAATACATCGCACGGAGAACCCATAACCA
JMSF028M15+ GAGAACCCATAACCA
rJMFF004O10- ACACAGTCGAATACATCGCACGGAGAACCCATAACCA
rJMSF028M15- AGCAGCGATCAATATAGAAAGTGACACAGTCGAATACATCGCACGGAGAACCCATAACCA
                      ____________________________________________________________
consensus AGCAGCGATCAATATAGAAAGTGACACAGTCGAATACATCGCACGGAGAACCCATAACCA
 
. : . : . : . : . : . :
JMFN037J14+ TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
JMFN011C10+ TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
JMSF028M15+ TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
rJMFF004O10- TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
rJMSF028M15- TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
                      ____________________________________________________________
consensus TAGCCAGAACTAAACGCAAACCAAGATCAAAAACATGAATTATCTATAAAATTTAGACCT
 
. : . : . : . : . : . :
JMFN037J14+ ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
JMFN011C10+ ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
JMSF028M15+ ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
rJMFF004O10- ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
rJMSF028M15- ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
                      ____________________________________________________________
consensus ACACCACCACTAATAAGATGGTGGCCTAATCGAAGATCAATTTAATTCCTCCAGCTTCCA
 
. : . : . : . : . : . :
JMFN037J14+ TCGGAAGAACCACCA-CCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
JMFN011C10+ TCGGAAGAACCACCA-CCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
JMSF028M15+ TCGGAAGAACCACCACCCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
rJMFF004O10- TCGGAAGAACCACCA-CCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
rJMSF028M15- TCGGAAGAACCACCA-CCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
                      ____________________________________________________________
consensus TCGGAAGAACCACCA-CCCCTAGAATAACCGCCACCATAACCGCGGTCGTTGCCGCCATA
 
. : . : . : . : . : . :
JMFN037J14+ TCCGCGGTCACCACCACCATAGCTACGGTCTCAACCGCCATATCCACGGTCACGGCCGCC
JMFN011C10+ TCCGCGGTCACCACCACCATAGCTACGGTCTCCACCGCCATATCCACGGTCACGGCCGCC
JMSF028M15+ TCCGCGGTCACCACCACCATAGCTACGGTCTCCACCGCCATATCCACGGTCACGGCCGCC
rJMFF004O10- TCCGCGGTCACCACCACCATAGCTACGGTCTCCACCGCCATATCCACGGTCACGGCCGCC
rJMSF028M15- TCCGCGGTCACCACCACCATAGCTACGGTCTCCACCGCCATATCCACGGTCACGGCCGCC
                      ____________________________________________________________
consensus TCCGCGGTCACCACCACCATAGCTACGGTCTCCACCGCCATATCCACGGTCACGGCCGCC
 
. : . : . : . : . : . :
JMFN037J14+ ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
JMFN011C10+ ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
JMSF028M15+ ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
rJMFF004O10- ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
rJMSF028M15- ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
JMFF004O10+ CCCTC
                      ____________________________________________________________
consensus ACCGTAACCTCCACCATAACCGCCTTCACGTCGACCGTATCCGCCTCCGCCTCCGCCCTC
 
. : . : . : . : . : . :
JMFN037J14+ ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
JMFN011C10+ ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
JMSF028M15+ ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
rJMFF004O10- ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
rJMSF028M15- ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
JMFF004O10+ ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
                      ____________________________________________________________
consensus ACGGCGACCACCACGGAAACCTCCGCCGCCGCCGCCGCTTCCGCGAGACTGTGCTTCATT
 
. : . : . : . : . : . :
JMFN037J14+ AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCC
JMFN011C10+ AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
JMSF028M15+ AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
rJMFF004O10- AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
rJMSF028M15- AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
JMFF004O10+ AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
                      ____________________________________________________________
consensus AACGGTAATGTTACGGCCGTCTAGGTTTTGGCCATTCATAGCCTCGATGGCGTCCCTCAT
 
. : . : . : . : . : . :
JMFN011C10+ GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCA
JMSF028M15+ GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCACGATC
rJMFF004O10- GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCACGATC
rJMSF028M15- GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCACGATC
JMFF004O10+ GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCACGATC
                      ____________________________________________________________
consensus GGCATGTTCGTCCCTGAAGGTGACAAAGCCAAATCCCCTGGATCTACCAGTCTCACGATC
 
. : . : . : . : . : . :
JMSF028M15+ ATTGATAATCTTCGATTCGAGAATCTCGCCATACTGACCGAAAGCCTCATCAAGGGTTCG
rJMFF004O10- ATTGATAATCTTCGATTCGAGAATCTCGCCATACTGACCGAAAGCCTCATCAAGGGTTCG
rJMSF028M15- ATTGATAATCTTCGATTCGAGAATCTCGCCATACTGACCGAAAGCCTCATCAAGGGTTCG
JMFF004O10+ ATTGATAATCTTCGATTCGAGAATCTCGCCATACTGACCGAAAGCCTCATCAAGGGTTCG
                      ____________________________________________________________
consensus ATTGATAATCTTCGATTCGAGAATCTCGCCATACTGACCGAAAGCCTCATCAAGGGTTCG
 
. : . : . : . : . : . :
JMSF028M15+ TTCGGTGGTGGCCCAGGCCAAGCCACCGACGAAACACCTAAACTCAACATCTGCGGAAGC
rJMFF004O10- TTCGGTGGTGGCCCAGGCCAAGCCACCGACGAAACACCTAAACTCAACATCTGCGGAAGC
rJMSF028M15- TTCGGTGGTGGCCCAGGCCAAGCCACCGACGAAACACCTAAACTCAACATCTGCGGAAGC
JMFF004O10+ TTCGGTGGTGGCCCAGGCCAAGCCACCGACGAAACACCTAAACTCAACATCTGCGGAAGC
                      ____________________________________________________________
consensus TTCGGTGGTGGCCCAGGCCAAGCCACCGACGAAACACCTAAACTCAACATCTGCGGAAGC
 
. : . : . : . : . : . :
JMSF028M15+ CATTTTTATA
rJMFF004O10- CATTTTTATA
rJMSF028M15- CATTTTTATATAGTCAAAAAAGCTTAACAAACCGAACGTAAC
JMFF004O10+ CATTTTTATATAGTCAAAAAAGCTTAACAAACCGAACGTAACAAAGGATAAGAAAGAGGC
                      ____________________________________________________________
consensus CATTTTTATATAGTCAAAAAAGCTTAACAAACCGAACGTAACAAAGGATAAGAAAGAGGC
 
. : . : . : . : . : . :
JMFF004O10+ AAAAGATTGATGAAGAGAAATTGGGAGAAACGATTGGATTATATAGGCGGAGGTTTCAAG
                      ____________________________________________________________
consensus AAAAGATTGATGAAGAGAAATTGGGAGAAACGATTGGATTATATAGGCGGAGGTTTCAAG
 
. : . : . : . : . : . :
JMFF004O10+ GTTTAAGGCAGATAAAGTTGCTCAAGAATATCGCTTTTTACCCTTTCTGCCCCAGATTTT
                      ____________________________________________________________
consensus GTTTAAGGCAGATAAAGTTGCTCAAGAATATCGCTTTTTACCCTTTCTGCCCCAGATTTT