Previous Contig 000230:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003M08Sequence584000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic706000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF004O02Sequence282000230 (38)gb:AF467728_18024301e-09Oryza sativa disease-resistent-related protein (RH3) mRNA, complete cds.731000230 (38)pir|S24346|S243464e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF006B11Sequence416000230 (38)gb:MSU09462_16872612e-45Medicago sativa Regen S clone pH3c126 histone H3.2 mRNA, partial cds.
JMFF008D12Sequence671000230 (38)gb:MMHIH3_21152883e-49Mouse gene coding for embryonic H3 histone.
JMFF009C12Sequence641000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF009C13Sequence605000230 (38)pir|S24346|S243461e-69histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic629000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF011F08Sequence543000230 (38)pir|S24346|S243461e-69histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic662000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF013H17Sequence585000230 (38)pir|S24346|S243464e-65histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic705000230 (38)pir|S24346|S243466e-65histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF014N17Sequence609000230 (38)pir|S24346|S243461e-63histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic674000230 (38)pir|S24346|S243461e-63histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF015B12Sequence575000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic707000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF023D12Sequence504000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic697000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF036M06Sequence575000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic663000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF043A17Sequence637000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic662000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFF050C11Sequence634000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic549000230 (38)gb:AF093108_17675879e-52Tortula ruralis histone H3 (rnp49) mRNA, partial cds.
JMFN007E12Sequence612000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN007G16Sequence528000230 (38)gb:AF093108_17675878e-56Tortula ruralis histone H3 (rnp49) mRNA, partial cds.
JMFN010J16Sequence629000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN013L17Sequence642000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN025E10Sequence652000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN028K23Sequence615000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN029B17Sequence629000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN035N17Sequence583000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN039D05Sequence629000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN039N24Sequence597000230 (38)pir|S24346|S243462e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFN040C07Sequence655000230 (38)pir|S24346|S243463e-70histon H3 protein [similarity] - Arabidopsis thaliana>gb:AY491505_1178431 Capsic
JMFS077C09Sequence526000230 (38)gb:AF093108_17675874e-45Tortula ruralis histone H3 (rnp49) mRNA, partial cds.
JMSF005L14Sequence454000230 (38)gb:AF467728_18024302e-61Oryza sativa disease-resistent-related protein (RH3) mRNA, complete cds.270011329 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023D12- AGCCGACAATAAATT
rJMFF043A17- AAATT
JMFN007G16+ AATT
JMFS077C09+ AAATT
rJMFF015B12- CATAGCCGACAATAAATT
rJMFF013H17- CATAGCCGACAATAAATT
rJMFF003M08- ATAAGCATAGCCGACAATAAATT
                      ____________________________________________________________
consensus ATAAGCATAGCCGACAATAAATT
 
. : . : . : . : . : . :
rJMFF023D12- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
JMFN040C07+ TTCATCATTATGGCAAATATGNCCCCAACAATATAAAAACAAG
JMFN025E10+ TCATCATTATGGCAAATATGNCCACAACAATATAAAAACAAG
rJMFF009C13- ATTATGGCAAATATGACCACAACAATATAAAAACAAG
JMFN029B17+ ATCATTATGGCAAATATGNCCACAACAATATAAAAACAAG
JMFN039D05+ TATGGCAAATATGNCCACAACAATATAAAACCAAG
JMFN028K23+ AAAACAAG
JMFN013L17+ TCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF043A17- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF050C11- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
JMFN007G16+ AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCNCAACAATATAAAAACAAG
JMFS077C09+ AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF015B12- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF013H17- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF008D12- AGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF036M06- ATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF009C12- CATTATGGCAAATATGACCACAACAATATAAAAACAAG
JMFF043A17+ CAATATAAAAACAAG
JMFN010J16+ TATAAAAACAAG
JMFN007E12+ CAAG
rJMFF011F08- TCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF003M08- AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
JMFF050C11+ TATAAAAACAAG
rJMFF014N17- AGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
rJMFF004O02- GTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
                      ____________________________________________________________
consensus AAAATCCAAACAGTATATTCATCATTATGGCAAATATGACCACAACAATATAAAAACAAG
 
. : . : . : . : . : . :
rJMFF023D12- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGTATTGAGACTTGAGA
JMFN040C07+ AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN025E10+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF009C13- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN029B17+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN039D05+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN028K23+ AACCAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN013L17+ AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF043A17- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF015B12+ TGAGACTTGAGA
rJMFF050C11- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN007G16+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFS077C09+ AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF015B12- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF013H17- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF008D12- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF036M06- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF009C12- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF043A17+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN010J16+ AAACAATTNCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN035N17+ TAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFN007E12+ AAACAATTGCCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF011F08- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF009C13+ AAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF003M08- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACCTGAGA
JMFN039N24+ TTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF050C11+ AAACAATTACCGTCTTAAAATCA-TTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF013H17+ CAACTAGGCATTGAGACTTGAGA
JMFF003M08+ ACTAGGCATTGAGACCTGAGA
JMFF036M06+ TGAGACTTGAGA
rJMFF014N17- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
JMFF014N17+ AAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
rJMFF004O02- AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
                      ____________________________________________________________
consensus AAACAATTACCGTCTTAAAATCATTTTTTATCACAATCAACTAGGCATTGAGACTTGAGA
 
. : . : . : . : . : . :
rJMFF023D12- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN040C07+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN025E10+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF009C13- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN029B17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN039D05+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN028K23+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN013L17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF043A17- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF015B12+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF050C11- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN007G16+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFS077C09+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF015B12- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF013H17- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF008D12- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF036M06- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF009C12- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF043A17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN010J16+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN035N17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN007E12+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF011F08- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF009C13+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF023D12+ TA
rJMFF003M08- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFN039N24+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF050C11+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF013H17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF003M08+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF036M06+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF011F08+ TACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
rJMFF014N17- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
JMFF014N17+ GCAAAGCAAAAGGTTATGTCTACTGCACAATCNTACTAGTAACAAGATCAGTCCCCAATA
rJMFF004O02- GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
                      ____________________________________________________________
consensus GCAAAGCAAAAGGTTATGTCTACTGCACAATCCTACTAGTAACAAGATCAGTCCCCAATA
 
. : . : . : . : . : . :
rJMFF023D12- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN040C07+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN025E10+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF009C13- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN029B17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN039D05+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN028K23+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN013L17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF043A17- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF015B12+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF050C11- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN007G16+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFS077C09+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF015B12- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF013H17- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF008D12- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF036M06- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF009C12- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF043A17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN010J16+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN035N17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN007E12+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF011F08- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF009C13+ GTTGCAGGGTTTAAGCGCGCTCCCCTNTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF023D12+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF003M08- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFN039N24+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF050C11+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF013H17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF006B11- TGAATGTCCTTCGGCA
JMFF003M08+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF036M06+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF011F08+ GTTGCAGGGTTTAAGCGCGCTCCCCTNTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
rJMFF014N17- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMFF014N17+ GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
JMSF005L14+ TTCGGCA
rJMFF004O02- GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
                      ____________________________________________________________
consensus GTTGCAGGGTTTAAGCGCGCTCCCCTCTAATGCGCCTAGCCAGCTGAATGTCCTTCGGCA
 
. : . : . : . : . : . :
rJMFF023D12- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN040C07+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN025E10+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF009C13- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN029B17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN039D05+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN028K23+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN013L17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF043A17- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF015B12+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF050C11- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN007G16+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFS077C09+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF015B12- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF013H17- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF008D12- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF036M06- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF009C12- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF043A17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN010J16+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN035N17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN007E12+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF011F08- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF009C13+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF023D12+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF003M08- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFN039N24+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF050C11+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF013H17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF006B11- TGATGGNAACTCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACNAACCAACTA
JMFF003M08+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF036M06+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
JMFF011F08+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
rJMFF014N17- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCACACAGACCAACTA
JMFF014N17+ TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCACACAGACCAACTA
JMSF005L14+ TGATGGTAACCNTCTTGGCATGGATGGCACACAGGTTGGTGTCNTCAAACAGACCAACTA
rJMFF004O02- TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
                      ____________________________________________________________
consensus TGATGGTAACCCTCTTGGCATGGATGGCACACAGGTTGGTGTCCTCAAACAGACCAACTA
 
. : . : . : . : . : . :
rJMFF023D12- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN040C07+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN025E10+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF009C13- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN029B17+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN039D05+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN028K23+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN013L17+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF043A17- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF015B12+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF050C11- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN007G16+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFS077C09+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF015B12- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF013H17- GGTATGCTTCCGC-GCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF008D12- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF036M06- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF009C12- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF043A17+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN010J16+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN035N17+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN007E12+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF011F08- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF009C13+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF023D12+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF003M08- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFN039N24+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF050C11+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF013H17+ GGTATGCTTCCGC-GCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF006B11- CGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACATNATGACTTTGGAACCTCATATCAC
JMFF003M08+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF036M06+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF011F08+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF014N17- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMFF014N17+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
JMSF005L14+ GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
rJMFF004O02- GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
                      ____________________________________________________________
consensus GGTATGCTTCCGCAGCCTCCTGGAGCGCGAGCACAGCATGACTTTGGAACCTCAGATCAG
 
. : . : . : . : . : . :
rJMFF023D12- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN040C07+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN025E10+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF009C13- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN029B17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN039D05+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN028K23+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN013L17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF043A17- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF015B12+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF050C11- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN007G16+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFS077C09+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF015B12- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF013H17- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF008D12- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF036M06- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF009C12- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF043A17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN010J16+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN035N17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN007E12+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF011F08- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF009C13+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF023D12+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF003M08- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFN039N24+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF050C11+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF013H17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF006B11- TCTTGAAGTCCTGGGCAATCTCACNGACAANNCTCTGGAAGGGAAGACTTGCGGATAAGG
JMFF003M08+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF036M06+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF011F08+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF014N17- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMFF014N17+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
JMSF005L14+ TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
rJMFF004O02- TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
                      ____________________________________________________________
consensus TCTTGAAGTCCTGGGCAATCTCACGGACAAGCCTCTGGAAGGGAAG-CTTGCGGATAAGG
 
. : . : . : . : . : . :
rJMFF023D12- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN040C07+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN025E10+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF009C13- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN029B17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN039D05+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN028K23+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN013L17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF043A17- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF015B12+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF050C11- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN007G16+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFS077C09+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGAC
rJMFF015B12- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF013H17- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF008D12- AGCTCAGTGCTC-TCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF036M06- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF009C12- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF043A17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN010J16+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN035N17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN007E12+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF011F08- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF009C13+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF023D12+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF003M08- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFN039N24+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF050C11+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF013H17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF006B11- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF003M08+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF036M06+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
JMFF011F08+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF014N17- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAG-GACAGTTCCAGGACGATAA
JMFF014N17+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAG-GACAGTTCCAGGACGATAA
JMSF005L14+ AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
rJMFF004O02- AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
                      ____________________________________________________________
consensus AGCTCAGTGCTCTTCTGATACTTGCGGATTTCACGGAGAGCAACAGTTCCAGGACGATAA
 
. : . : . : . : . : . :
rJMFF023D12- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN040C07+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN025E10+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF009C13- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN029B17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN039D05+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN028K23+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN013L17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF043A17- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF015B12+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF050C11- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN007G16+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGG
rJMFF015B12- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF013H17- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF008D12- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF036M06- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF009C12- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF043A17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN010J16+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN035N17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN007E12+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF011F08- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF009C13+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF023D12+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF003M08- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFN039N24+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF050C11+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF013H17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF006B11- CGATGGGGCTTTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF003M08+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF036M06+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF011F08+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF014N17- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF014N17+ CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMSF005L14+ CGATGGGGC-TTCTTCACTCCACCAGTGGTGGGGGCTGATTTCCGGGCAGCCTTCGTAGC
rJMFF004O02- CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
JMFF004O02+ CTCCCCCAGNGGTAGGGGGTGATTTCCGGGCANCCTTCGTAGC
                      ____________________________________________________________
consensus CGATGGGGC-TTCTTCACTCCACCAGTGGTAGGGGCTGATTTCCGGGCAGCCTTCGTAGC
 
. : . : . : . : . : . :
rJMFF023D12- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN040C07+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN025E10+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF009C13- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN029B17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN039D05+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN028K23+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN013L17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF043A17- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF015B12+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF050C11- A
rJMFF015B12- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF013H17- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF008D12- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF036M06- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF009C12- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF043A17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN010J16+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN035N17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN007E12+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF011F08- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF009C13+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF023D12+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF003M08- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFN039N24+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF050C11+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF013H17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF006B11- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF003M08+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF036M06+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF011F08+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF014N17- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF014N17+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMSF005L14+ AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
rJMFF004O02- AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
JMFF004O02+ AAGCTGCTTCCTCGGNGCCTTTCCCCCGGTAGACTTNCGGGCAGTTTGNTTAGTTCGNGC
                      ____________________________________________________________
consensus AAGCTGCTTCCTCGGAGCCTTTCCACCGGTAGACTTACGGGCAGTTTGCTTAGTTCGAGC
 
. : . : . : . : . : . :
rJMFF023D12- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN040C07+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN025E10+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF009C13- CATATCCTTCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAG
JMFN029B17+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAA
JMFN039D05+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGA
JMFN028K23+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAAT
JMFN013L17+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF043A17- CATATCCTTCG
JMFF015B12+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF015B12- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF013H17- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF008D12- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF036M06- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF009C12- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF043A17+ CATATCCTTCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN010J16+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN035N17+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN007E12+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF011F08- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF009C13+ CATATCCTTCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF023D12+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF003M08- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFN039N24+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF050C11+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF013H17+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF006B11- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAAC
JMFF003M08+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF036M06+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF011F08+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF014N17- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMFF014N17+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
JMSF005L14+ CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
rJMFF004O02- CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTGA--AAGA-TTC
JMFF004O02+ CATATCCTCCGATTATCNAGCAAAAATCNAACGCAACAACAAGAATNTGA--AAGA-TTC
                      ____________________________________________________________
consensus CATATCCTCCGATTATCAAGCAAAAATCAAACGCAACAACAAGAATCTCAACAGGATTTT
 
. : . : . : . : . : . :
rJMFF023D12- GGTTGGAACTCACGGAAAGA-GAAA
JMFN040C07+ GGTTGGAACTCACG
JMFN025E10+ GGTTGGAAC
JMFN013L17+ GG
JMFF015B12+ GGTTGGAACTCACGGAAAGT-GAAA
rJMFF015B12- GGTTGGAACTCACGGAAAGT-GAAA
rJMFF013H17- GGTTGGAACTCACGGAAAGC-GAAAC
rJMFF008D12- GGTTGGAACTCACGGAAAGC-GAAAC
rJMFF036M06- GGTTGGAACTCACGGAAAGC-GAAAC
rJMFF009C12- GGTTG
JMFF043A17+ GGTTGGAACTCACGGAAAGC-GAAA
JMFN010J16+ GGTTGGAACTCACGGAAAG
JMFN007E12+ GGTTGGAAC
rJMFF011F08- GGTTGGAACTCACGGAAAGC-GAAAC
JMFF009C13+ GGTTGGAACTCACGGAAAGC-GAAA
JMFF023D12+ GGTTGGAACTCACGGAAAGA-GAAA
rJMFF003M08- GGTTGGAAATCACGGGAAGC-GAAAC
JMFN039N24+ GGTTGGAACTCACGG
JMFF050C11+ GGTTGGAACTCACGGAAAGC-GAAAC
JMFF013H17+ GGTTGGAACTCACGGAAAGC-GAAAC
JMFF003M08+ GGTTGGAAATCACGGGAAGC-GAAAC
JMFF036M06+ GGTTGGAACTCACGGAAAGC-GAAAC
JMFF011F08+ GGTTGGAACTCACGGAAAGC-GAAAC
rJMFF014N17- GGTTGGAACTCACGGAAAGC-GAAAC
JMFF014N17+ GGTTGGAACTCACGGAAAGC-GAAAC
JMSF005L14+ GGTTGGAACTCACGGAAAGC-GAAAC
rJMFF004O02- ACACGAAAAAGATAAAAATCGGAGACAACCGATCCATAATTCAAACGTTACAGAAATTCA
JMFF004O02+ NCNCGAAAAAGATAAAAATNGGNGACNACCGATCCATAATTCAAACGTTACAGAGATTCA
                      ____________________________________________________________
consensus GGTTGGAACTCACGGAAAGC-GAAACAACCGATCCATAATTCAAACGTTACAGAGATTCA
 
. : . : . : . : . : . :
rJMFF004O02- NCATTCAAATCGGAAGAAAAAAAAAACG
JMFF004O02+ ACATTCAAATNGGAAGAAAAAAAAAACGTAAAAAAAGAGAGAGAAAATAGAGAACACTAA
                      ____________________________________________________________
consensus ACATTCAAATCGGAAGAAAAAAAAAACGTAAAAAAAGAGAGAGAAAATAGAGAACACTAA