Previous Contig 000227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004N06Sequence641000227 (7)gb:AY093107_15750612e-36Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846707000227 (7)gb:AY093107_15750615e-35Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846
JMFF031F10Sequence606000227 (7)gb:AY093107_15750611e-36Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846699000227 (7)gb:AY093107_15750615e-35Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846
JMFN005F05Sequence549000227 (7)gb:AY093107_15750615e-13Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846
JMSF011B07Sequence203000227 (7)gb:AY093107_15750612e-09Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846715000227 (7)gb:AY093107_15750615e-35Arabidopsis thaliana unknown protein (At2g16630) mRNA, complete cds.>gb:BT008846

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005F05+ GTG
                      ____________________________________________________________
consensus GTG
 
. : . : . : . : . : . :
JMFN005F05+ GTGAACAATTATTATGATTAGTAATGAACATTAGTTTATAAAAAACTGTTTGCCATCTAA
                      ____________________________________________________________
consensus GTGAACAATTATTATGATTAGTAATGAACATTAGTTTATAAAAAACTGTTTGCCATCTAA
 
. : . : . : . : . : . :
JMFN005F05+ TCTCCATTTAATAACAAAAGGGAAATAAGTACTTCATTGTAACATGAATCACGGACAAAT
rJMSF011B07- CTTCATTGTAACATGAATCACGGACAAAT
rJMFF004N06- CTTCATTGTAACATGAATCACGGACAAAT
rJMFF031F10- TTGTAACATGAATCACGGACAAAT
                      ____________________________________________________________
consensus TCTCCATTTAATAACAAAAGGGAAATAAGTACTTCATTGTAACATGAATCACGGACAAAT
 
. : . : . : . : . : . :
JMFN005F05+ TAAAGGTGATGATACAGGAATACTAACCATATATCATTATCAGTAAAAGGACCTGACAGA
rJMSF011B07- TAAAGGTGATGATACAGGAATACTAACCATATATCATTATCAGTAAAAGGACCTGACAGA
rJMFF004N06- TAAAGGTGATGATACAGGAATACTAACCATATATCATTATCAGTAAAAGGACCTGACAGA
rJMFF031F10- TAAAGGTGATGATACAGGAATACTAACCATATATCATTATCAGTAAAAGGACCTGACAGA
                      ____________________________________________________________
consensus TAAAGGTGATGATACAGGAATACTAACCATATATCATTATCAGTAAAAGGACCTGACAGA
 
. : . : . : . : . : . :
JMFN005F05+ AATGCGTATTTTGGTCCATACACAACAATAACCATAACAAATATATATTGAGTATTAGTA
rJMSF011B07- AATGCGTATTTTGGTCCATACACAACAATAACCATAACAAATATATATTGAGTATTAGTA
rJMFF004N06- AATGCGTATTTTGGTCCATACACAACAATAACCATAACAAATATATATTGAGTATTAGTA
rJMFF031F10- AATGCGTATTTTGGTCCATACACAACAATAACCATAACAAATATATATTGAGTATTAGTA
                      ____________________________________________________________
consensus AATGCGTATTTTGGTCCATACACAACAATAACCATAACAAATATATATTGAGTATTAGTA
 
. : . : . : . : . : . :
JMFN005F05+ TAACCCAACATTACAAGCCATCCATAAACCCAAAAATTGACTGTATAGTAGAATACACGT
rJMSF011B07- TAACCCAACATTACAAGCCATCCATAAACCCAGAAATTGACTGTATAGTAGAATACACGT
rJMFF004N06- TAACCCAACATTACAAGCCATCCATAAACCCAGAAATTGACTGTATAGTAGAATACACGT
rJMFF031F10- TAACCCAACATTACAAGCCATCCATAAACCCAGAAATTGACTGTATAGTAGAATACACGT
                      ____________________________________________________________
consensus TAACCCAACATTACAAGCCATCCATAAACCCAGAAATTGACTGTATAGTAGAATACACGT
 
. : . : . : . : . : . :
JMFN005F05+ ACTATATAAATCAAGAATTTGTGGTGCAAGGAGTGAATCTGCAGGTAGAAGTAGGCAGAG
rJMSF011B07- ACTATATAAATCAAGAATTTGTGGTGCAAGGAGTGAATCTGCAGGTAGAAGTAGGCAGAG
rJMFF004N06- ACTATATAAATCAAGAATTTGTGGTGCAAGGAGTGAATCTGCAGGTAGAAGTAGGCAGAG
rJMFF031F10- ACTATATAAATCAAGAATTTGTGGTGCAAGGAGTGAATCTGCAGGTAGAAGTAGGCAGAG
                      ____________________________________________________________
consensus ACTATATAAATCAAGAATTTGTGGTGCAAGGAGTGAATCTGCAGGTAGAAGTAGGCAGAG
 
. : . : . : . : . : . :
JMFN005F05+ AGATTCCAGAGTTTGCTCTCATGAAACTGAGAGCAGTGTGGAGGACTTGCTGTGTAGATC
rJMSF011B07- AGATTCCAGAGTTTGCTCTCATGAAACTGAGAGCAGTGTGGAGGACTTGCTGTGTAGATC
rJMFF004N06- AGATTCCAGAGTTTGCTCTCATGAAACTGAGAGCAGTGTGGAGGACTTGCTGTGTAGATC
rJMFF031F10- AGATTCCAGAGTTTGCTCTCATGAAACTGAGAGCAGTGTGGAGGACTTGCTGTGTAGATC
                      ____________________________________________________________
consensus AGATTCCAGAGTTTGCTCTCATGAAACTGAGAGCAGTGTGGAGGACTTGCTGTGTAGATC
 
. : . : . : . : . : . :
JMFN005F05+ CCATCAATGCCCAATTCATTCGTTCGACGACTCCCAGAGGGTGGAATGGGAACAGTAAGG
rJMSF011B07- CCATCAATGCCCAATTCATTCGTTCGACGACTCCCAGAGGGTGGAATGGGAACAGTAAGG
rJMFF004N06- CCATCAATGCCCAATTCATTCGTTCGACGACTCCCAGAGGGTGGAATGGGAACAGTAAGG
rJMFF031F10- CCATCAATGCCCAATTCATTCGTTCGACGACTCCCAGAGGGTGGAATGGGAACAGTAAGG
                      ____________________________________________________________
consensus CCATCAATGCCCAATTCATTCGTTCGACGACTCCCAGAGGGTGGAATGGGAACAGTAAGG
 
. : . : . : . : . : . :
JMFN005F05+ TAGTATATGAGTTGAGAAGGGCTGTTGTTCCTTCCCTTAGCAGTGTCCTGTAGGGCTCCC
rJMSF011B07- TAGTATATGAGTTGAGAAGGGCTGTTGTTCCTTCCCTTAGCAGTGTCCTGTAGGGCTCCC
rJMFF004N06- TAGTATATGAGTTGAGAAGGGCTGTTGTTCCTTCCCTTAGCAGTGTCCTGTAGGGCTCCC
rJMFF031F10- TAGTATATGAGTTGAGAAGGGCTGTTGTTCCTTCCCTTAGCAGTGTCCTGTAGGGCTCCC
                      ____________________________________________________________
consensus TAGTATATGAGTTGAGAAGGGCTGTTGTTCCTTCCCTTAGCAGTGTCCTGTAGGGCTCCC
 
. : . : . : . : . : . :
JMFN005F05+ CTCTTC
rJMSF011B07- CTCTTCCCTTCATCCCTTCCCAAAGTGTCATGTCTGTTCCATATTTCCGGGCCGCCAGCA
rJMFF004N06- CTCTTCCCTTCATCCCTTCCCAAAGTGTCATGTCTGTTCCATATTTCCGGGCCGCCAGCA
rJMFF031F10- CTCTTCCCTTCATCCCTTCCCAAAGTGTCATGTCTGTTCCATATTTCCGGGCCGCCAGCA
                      ____________________________________________________________
consensus CTCTTCCCTTCATCCCTTCCCAAAGTGTCATGTCTGTTCCATATTTCCGGGCCGCCAGCA
 
. : . : . : . : . : . :
rJMSF011B07- GCCCGAAAACAACCCCCACTTTTGCATCAGGACTCACAACCTTCCAATAGCATCTGTATT
rJMFF004N06- GCCCGAAAACAACCCCCACTTTTGCATCAGGACTCACAACCTTCCAATAGCATCTGTATT
rJMFF031F10- GCCCGAAAACAACCCCCACTTTTGCATCAGGACTCACAACCTTCCAATAGCATCTGTATT
                      ____________________________________________________________
consensus GCCCGAAAACAACCCCCACTTTTGCATCAGGACTCACAACCTTCCAATAGCATCTGTATT
 
. : . : . : . : . : . :
rJMSF011B07- CTGGCATTATCCATTTCTGGTATGGGCAGGCTGAAGCTTCTAGAAATGGGGATGGAGGCA
rJMFF004N06- CTGGCATTATCCATTTCTGGTATGGGCAGGCTGAAGCTTCTAGAAATGGGGATGGAGGCA
rJMFF031F10- CTGGCATTATCCATTTCTGGTATGGGCAGGCTGAAGCTTCTAGAAATGGGGATGGAGGCA
JMFF031F10+ TCTAGAAATGGGGATGGAGGCA
JMFF004N06+ GTATGGGCAGGCTGAAGCTTCTAGAAATGGGGATGGAGGCA
                      ____________________________________________________________
consensus CTGGCATTATCCATTTCTGGTATGGGCAGGCTGAAGCTTCTAGAAATGGGGATGGAGGCA
 
. : . : . : . : . : . :
rJMSF011B07- TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
rJMFF004N06- TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
rJMFF031F10- TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
JMFF031F10+ TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
JMFF004N06+ TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
                      ____________________________________________________________
consensus TTGGGGGTAAGCTTGGCAATGGCGGCAGTGCAGGCGTTACAGGCGGCGAAGGAGTGACTG
 
. : . : . : . : . : . :
rJMSF011B07- GTGCGG
rJMFF004N06- GTGCGGGCACGGA
rJMFF031F10- GTGCGGGCACGGA
JMFF031F10+ GTGCGGGCACGGAAGAAGATGGGCAGAAGGACATAGGCTGAGCAGGCTGAGAAATCAGAG
JMFF004N06+ GTGCGGGCACGGAAGAAGATGGGCAGAAGGACATAGGCTGAGCAGGCTGAGAAATCAGAG
                      ____________________________________________________________
consensus GTGCGGGCACGGAAGAAGATGGGCAGAAGGACATAGGCTGAGCAGGCTGAGAAATCAGAG
 
. : . : . : . : . : . :
JMFF031F10+ CATCCACTGCATACATTTCCATATCAAACATCCTGAACATTAGCTTTAGAGGCTTGGGTG
JMFF004N06+ CATCCACTGCATACATTTCCATATCAAACATCCTGAACATTAGCTTTAGAGGCTTGGGTG
                      ____________________________________________________________
consensus CATCCACTGCATACATTTCCATATCAAACATCCTGAACATTAGCTTTAGAGGCTTGGGTG
 
. : . : . : . : . : . :
JMFF031F10+ GACCGCCGGCTGCCCCGCAGGTTGCCGACGGTTGGCTACTGCCGGAAACCTGCGCAAAAC
JMFF004N06+ GACCGCCGGCTGCCCCGCAGGTTGCCGACGGTTGGCTACTGCCGGAAACCTGCGCAAAAC
                      ____________________________________________________________
consensus GACCGCCGGCTGCCCCGCAGGTTGCCGACGGTTGGCTACTGCCGGAAACCTGCGCAAAAC
 
. : . : . : . : . : . :
JMFF031F10+ AGTTGCTCAAATCTTGGGTGCTGTCAAATCTCATGTTGAAACCTCCTAACCAATTCGTAC
JMFF004N06+ AGTTGCTCAAATCTTGGGTGCTGTCAAATCTCATGTTGAAACCTCCTAACCAATTCGTAC
                      ____________________________________________________________
consensus AGTTGCTCAAATCTTGGGTGCTGTCAAATCTCATGTTGAAACCTCCTAACCAATTCGTAC
 
. : . : . : . : . : . :
JMFF031F10+ TTTCCTCTCCCCGTGTTGTCATTTGCCCGTTCCCGTCTGGGCATGCCATTGCCACTTTTA
JMSF011B07+ TTGTCATTTGCCCGTTCCCGTCTGGGCATGCCATTGCCACTTTTA
JMFF004N06+ TTTCCTCTCCCCGTGTTGTCATTTGCCCGTTCCCGTCTGGGCATGCCATTGCCACTTTTA
                      ____________________________________________________________
consensus TTTCCTCTCCCCGTGTTGTCATTTGCCCGTTCCCGTCTGGGCATGCCATTGCCACTTTTA
 
. : . : . : . : . : . :
JMFF031F10+ TTCCGTATACTGGATAATCAAAAAGGGAAACTTTGCCATCTTTACACTGATCACAGAACA
JMSF011B07+ TTCCGTATACTGGATAATCAAAAAGGGAAACTTTGCCATCTTTACACTGATCACAGAACA
JMFF004N06+ TTCCGTATACTGGATAATCAAAAAGGGAAACTTTGCCATCTTTACACTGATCACAGAACA
                      ____________________________________________________________
consensus TTCCGTATACTGGATAATCAAAAAGGGAAACTTTGCCATCTTTACACTGATCACAGAACA
 
. : . : . : . : . : . :
JMFF031F10+ CAGTGCCGGAGATAATGGTTAGCCCATGAGTTGTACCAATGGCAGCGGCTGCAGTCAGAA
JMSF011B07+ CAGTGCCGGAGATAATGGTTAGCCCATGAGTTGTACCAATGGCAGCGGCTGCAGTCAGAA
JMFF004N06+ CAGTGCCGGAGATAATGGTTAGCCCATGAGTTGTACCAATGGCAGCGGCTGCAGTCAGAA
                      ____________________________________________________________
consensus CAGTGCCGGAGATAATGGTTAGCCCATGAGTTGTACCAATGGCAGCGGCTGCAGTCAGAA
 
. : . : . : . : . : . :
JMFF031F10+ AAGCAGCGAACCAAAGCTTGAAGAACCAATCCATGGCGGATAAGATGATGGTGCAGAATC
JMSF011B07+ AAGCAGCGAACCAAAGCTTGAAGAACCAATCCATGGC
JMFF004N06+ AAGCAGCGAACCAAAGCTTGAAGAACCAATCCATGGCGGATAAGATGATGGTGCAGAATC
                      ____________________________________________________________
consensus AAGCAGCGAACCAAAGCTTGAAGAACCAATCCATGGCGGATAAGATGATGGTGCAGAATC
 
. : . : . : . : . : . :
JMFF031F10+ AGGGGATTTAAATTTAATAAAGCAGCAGGAATGGCAGAAGCTGT
JMFF004N06+ AGGGGATTTAAATTTAATAAAGCAGCAGGAATGGCAGAAGCTGTAAAGGAGGAGCGATGA
                      ____________________________________________________________
consensus AGGGGATTTAAATTTAATAAAGCAGCAGGAATGGCAGAAGCTGTAAAGGAGGAGCGATGA