Previous Contig 000226:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004M19Sequence465000226 (3)pir|H86192|H861927e-18hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889600 Arabid730008348 (2)pir|H86192|H861922e-72hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889600 Arabid
JMFS010A07Sequence608000226 (3)pir|H86192|H861927e-33hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889600 Arabid
JMSF052O11Sequence674000226 (3)pir|H86192|H861926e-42hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889600 Arabid796008348 (2)pir|H86192|H861923e-83hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889600 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052O11+ CCACAAGAATATCACTGAGTAGTCC
                      ____________________________________________________________
consensus CCACAAGAATATCACTGAGTAGTCC
 
. : . : . : . : . : . :
JMFS010A07+ CAGCAGCTCCACTTTTTTCCCAGCATCCATGGAT
JMSF052O11+ ACAATGGGGCGTTCTGGTGCATATAACAGCAGCTCCACTTTTTTCCCAGCATCCATGGAT
                      ____________________________________________________________
consensus ACAATGGGGCGTTCTGGTGCATATAACAGCAGCTCCACTTTTTTCCCAGCATCCATGGAT
 
. : . : . : . : . : . :
JMFS010A07+ TTCTGAATGGCATCTCCTCCAGACTTAGAGATCATCACCACAGGAAATTTTATGTGTACA
JMSF052O11+ TTCTGAATGGCATCTCCTCCAGACTTAGAGATCATCACCACAGGAAATTTTATGTGTACA
                      ____________________________________________________________
consensus TTCTGAATGGCATCTCCTCCAGACTTAGAGATCATCACCACAGGAAATTTTATGTGTACA
 
. : . : . : . : . : . :
JMFS010A07+ TCCTCATTTCCAGGACAACCCATCTCAGTAAGAGCTTCATCGTCATTTATTATCACAAGG
JMSF052O11+ TCCTCATTTCCAGGACAACCCATCTCAGTAAGAGCTTCATCGTCATTTATTATCACAAGG
                      ____________________________________________________________
consensus TCCTCATTTCCAGGACAACCCATCTCAGTAAGAGCTTCATCGTCATTTATTATCACAAGG
 
. : . : . : . : . : . :
JMFS010A07+ CCTCCAGCACCTCCTGTTTGCGCAAATTTAGCCTTGGTTACAAAATCACATTCACCACGT
JMSF052O11+ CCTCCAGCACCTCCTGTTTGCGCAAATTTAGCCTTGGTTACAAAATCACATTCACCACGT
JMFF004M19+ GTTTGCGCAAATTTAGCCTTGGTTACAAAATCACATTCACCACGT
                      ____________________________________________________________
consensus CCTCCAGCACCTCCTGTTTGCGCAAATTTAGCCTTGGTTACAAAATCACATTCACCACGT
 
. : . : . : . : . : . :
JMFS010A07+ ATAGCTAATGCCATAGCGCCTGATAACTTTCGAGAGATATTGGAACAGCAATTCAAGGGG
JMSF052O11+ ATAGCTAATGCCATAGCGCCTGATAACTTTCGAGAGATATTGGAACAGCAATTCAAGGGG
JMFF004M19+ ATAGCTAATGCCATAGCGCCTGATAACTTTTGAGAGATATTGGAACAGCAATTCAAGGGG
                      ____________________________________________________________
consensus ATAGCTAATGCCATAGCGCCTGATAACTTTCGAGAGATATTGGAACAGCAATTCAAGGGG
 
. : . : . : . : . : . :
JMFS010A07+ TTTGTGTAAGTAGCAGGTAATTTGACGCCATCTTTTTCCTTAGTAGGCAAAAGAGTACCA
JMSF052O11+ TTTGTGTAAGTAGCAGGTAATTTGACGCCATCTTTTTCCTTAGTAGGCAAAAGAGTACCA
JMFF004M19+ TTTGTGTAAGTAGCAGGTAATTTGACGCCATCTTTTTCCTTAGTAGGCAAAAGAGTACCA
                      ____________________________________________________________
consensus TTTGTGTAAGTAGCAGGTAATTTGACGCCATCTTTTTCCTTAGTAGGCAAAAGAGTACCA
 
. : . : . : . : . : . :
JMFS010A07+ AATGCTGCACTTATTCCTCCTATTTCCTCCCCTTCAGTGCCATCCAACCATGTCTTGACC
JMSF052O11+ AATGCTGCACTTATTCCTCCTATTTCCTCCCCTTCAGTGCCATCCAACCATGTCTTGACC
JMFF004M19+ AATGCTGCACTTATTCCTCCTATTTCCTCCCCTTCAGTGCCATCCAACCATGTCTTGACC
                      ____________________________________________________________
consensus AATGCTGCACTTATTCCTCCTATTTCCTCCCCTTCAGTGCCATCCAACCATGTCTTGACC
 
. : . : . : . : . : . :
JMFS010A07+ TTGACCAATTTGTAAGGATTGTTGCAGGAGGCAGACACGTTGGGGGAGGCGCGTGTAACA
JMSF052O11+ TTGACCAATTTGTAAGGATTGTTGCAGGAGGCAGACACGTTGGGGGAGGCGCGTGTAACA
JMFF004M19+ TTGACCAATTTGTAAGGATTGTTGCAGGAGGCAGACACGTTGGGGGAGGCGCGTGTAACA
                      ____________________________________________________________
consensus TTGACCAATTTGTAAGGATTGTTGCAGGAGGCAGACACGTTGGGGGAGGCGCGTGTAACA
 
. : . : . : . : . : . :
JMFS010A07+ TCGTCGTTTGCGGCGGCTGCCAATGACGATATAGAGAGGAAAGCGACAAAGAATCCTAAA
JMSF052O11+ TCGTCGTTTGCGGCGGCTGCCAATGACGATATAGAGAGGAAAGCGACAAAGAATCCTAAA
JMFF004M19+ TCGTCGTTTGCGGCGGCTGCCAATGACGATATAGAGAGGAAAGCGACAAAGAATCCTAAA
                      ____________________________________________________________
consensus TCGTCGTTTGCGGCGGCTGCCAATGACGATATAGAGAGGAAAGCGACAAAGAATCCTAAA
 
. : . : . : . : . : . :
JMFS010A07+ CCGATAAAGCGCAGAGAAACATACATTGCTCCAGATCGATCGATCTCCTCTCCTTTGTTA
JMSF052O11+ CCGATAAAGCGCAGAGAAACATCCATTGCTCCAGATCGATCGATCTCCTCTCCTTTGTTA
JMFF004M19+ CCGATAAAGCGCAGAGAAACATCCATTGCTCCAGATCGATCGATCTCCTCTCCTTTGTTA
                      ____________________________________________________________
consensus CCGATAAAGCGCAGAGAAACATCCATTGCTCCAGATCGATCGATCTCCTCTCCTTTGTTA
 
. : . : . : . : . : . :
JMFS010A07+ TTTTCTTCCCTTTGGCCTTC-TCTTCTGATGCGAG
JMSF052O11+ TTTTCTTCCCTTTGGCCTTC-TCTTCTGATGCGAGCTCCCTCTACCTG
JMFF004M19+ TTTTCTTCCCTTTGGCCTTCTTCTTCTGATGCGAGCTCCCTCTACCTGTGCATCTACATT
                      ____________________________________________________________
consensus TTTTCTTCCCTTTGGCCTTC-TCTTCTGATGCGAGCTCCCTCTACCTGTGCATCTACATT