Previous Contig 000217:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K13Sequence516000217 (4)sp|Q05085|CHL1_ARATH4e-42Nitrate/chlorate transporter.>pir|A45772|A45772 nitrate-inducible nitrate transp750009226 (5)gb:AB102806_15263372e-68Nicotiana tabacum NtNRT1.1-t mRNA for nitrate transporter, complete cds.
JMFF021L07Sequence541000217 (4)gb:NPL277084_16910784e-51Nicotiana plumbaginifolia mRNA for putative low-affinity nitrate transporter (nr680009226 (5)gb:AB128925_15283562e-62Prunus persica PpNRT1 gene for nitrate transporter, partial cds.
JMFS136F05Sequence605000217 (4)gb:NPL277084_16910785e-63Nicotiana plumbaginifolia mRNA for putative low-affinity nitrate transporter (nr
JMSF025I16Sequence641000217 (4)gb:NPL277084_16910781e-65Nicotiana plumbaginifolia mRNA for putative low-affinity nitrate transporter (nr746009226 (5)gb:AB102806_15263374e-75Nicotiana tabacum NtNRT1.1-t mRNA for nitrate transporter, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS136F05+ TCGAACTGGTCGGACCCGAAGCCGGA
JMSF025I16+ CTTGTCGCTCTCGTCGAACTGGTCGGACCCGAAGCCGGA
                      ____________________________________________________________
consensus CTTGTCGCTCTCGTCGAACTGGTCGGACCCGAAGCCGGA
 
. : . : . : . : . : . :
JMFS136F05+ CACGCTGGACTTCAGGCCGCCGGTGCCCAGCGCCGTCAGGTAAAGGGCCGCGTAGAGGAC
JMSF025I16+ CACGCTGGACTTCAGGCCGCCGGTGCCCAGCGCCGTCAGGTAAAGGGCCGCGTAGAGGAC
                      ____________________________________________________________
consensus CACGCTGGACTTCAGGCCGCCGGTGCCCAGCGCCGTCAGGTAAAGGGCCGCGTAGAGGAC
 
. : . : . : . : . : . :
JMFS136F05+ AAGCAGCTGGGCGCCGCTCGCCGGAATACATGCCGGGCTTCCCCGTTCACACTTTGGAGG
JMSF025I16+ AAGCAGCTGGGCGCCGCTCGCCGGAATACATGCCGGGCTTCCCCGTTCACACTTTGGAGG
JMFF021L07+ GG
                      ____________________________________________________________
consensus AAGCAGCTGGGCGCCGCTCGCCGGAATACATGCCGGGCTTCCCCGTTCACACTTTGGAGG
 
. : . : . : . : . : . :
JMFS136F05+ CCTTAGGCTTGGTATTATTGTTGAGATTGTCAAAATAGTCACACCCGTCGCTTGAACAGT
JMSF025I16+ CCTTAGGCTTGGTATTATTGTTGAGATTGTCAAAATAGTCACACCCGTCGCTTGAACAGT
JMFF021L07+ CCTTAGGCTTGGTATTATTGTTGAGATTGTCAAAATAGTCACACCCGTCGCTTGAACAGT
JMFF004K13+ GATTGTCAAAATAGTCACACCCGTCGCTTGAACAGT
                      ____________________________________________________________
consensus CCTTAGGCTTGGTATTATTGTTGAGATTGTCAAAATAGTCACACCCGTCGCTTGAACAGT
 
. : . : . : . : . : . :
JMFS136F05+ GGTAAAGATGGCGATTGTCAAGTACCTTCCGAGGAAAGTGTCAGCAATGAAGCCACCAAG
JMSF025I16+ GGTAAAGATGGCGATTGTCAAGTACCTTCCGAGGAAAGTGTCAGCAATGAAGCCACCAAG
JMFF021L07+ GGTAAAGATGGCGATTGTCAAGTACCTTCCGAGGAAAGTGTCAGCAATGAAGCCACCAAG
JMFF004K13+ GGTAAAGATGGCGATTGTCAAGTACCTTCCGAGGAAAGTGTCAGCAATGAAGCCACCAAG
                      ____________________________________________________________
consensus GGTAAAGATGGCGATTGTCAAGTACCTTCCGAGGAAAGTGTCAGCAATGAAGCCACCAAG
 
. : . : . : . : . : . :
JMFS136F05+ GAGGGTGAGCATGAAGGAAGTTCCAAGAAAGTTAGTGACGTTATTGGCGGCGTTAGCATT
JMSF025I16+ GAGGGTGAGCATGAAGGAAGTTCCAAGAAAGTTAGTGACGTTATTGGCGGCGTTAGCATT
JMFF021L07+ GAGGGTGAGCATGAAGGAAGTTCCAAGAAAGTTAGTGACGTTATTGGCGGCGTTAGCATT
JMFF004K13+ GAGGGTGAGCATGAAGGAAGTTCCAAGAAAGTTAGTGACGTTATTGGCGGCGTTAGCATT
                      ____________________________________________________________
consensus GAGGGTGAGCATGAAGGAAGTTCCAAGAAAGTTAGTGACGTTATTGGCGGCGTTAGCATT
 
. : . : . : . : . : . :
JMFS136F05+ CCCTAAATGCATGGTCCCCGTCAAGTAGGTCACAAGGTTGACGGCGATGCCCAACGTCGT
JMSF025I16+ CCCTAAATGCATGGTCCCCGTCAAGTAGGTCACAAGGTTGACGGCGATGCCCAACGTCGT
JMFF021L07+ CCCTAAATGCATGGTCCCCGTCAAGTAGGTCACAAGGTTGACGGCGATGCCCAACGTCGT
JMFF004K13+ CCCTAAATGCATGGTCCCCGTCAAGTAGGTCACAAGGTTGACGGCGATGCCCAACGTCGT
                      ____________________________________________________________
consensus CCCTAAATGCATGGTCCCCGTCAAGTAGGTCACAAGGTTGACGGCGATGCCCAACGTCGT
 
. : . : . : . : . : . :
JMFS136F05+ CAACCTCTCAC-AAGCCTCAACCCCCAAAATCATGGCGGCGCTGCTCCAGCCGCCGGAGG
JMSF025I16+ CAACCTCTCAC-AAGCCTCAACCCCCAAAATCATGGCGGCGCTGCTCCAGCCGCCGGAGG
JMFF021L07+ CAACCTCTCAC-AAGCCTCAACCCCCAAAATCATGGCGGCGCTGCTCCAGCCGCCGGAGG
JMFF004K13+ CAACCTCTCACAAAGCCTCAACCCCCAAAATCATGGCGGCGCTGCTCCAGCCGCCGGAGG
                      ____________________________________________________________
consensus CAACCTCTCAC-AAGCCTCAACCCCCAAAATCATGGCGGCGCTGCTCCAGCCGCCGGAGG
 
. : . : . : . : . : . :
JMFS136F05+ AGGAGCGGAGGGCGGGGCGGCCATGGAAGTCCCAGGCATCTGGGAGGATTTTTGCATCAT
JMSF025I16+ AGGAGCGGAGGGCGGGGCGGCCATGGAAGTCCCAGGCATCTGGGAGGATTTTTGCATCAT
JMFF021L07+ AGGAGCGGAGGGCGGGGCGGCCATGGAAGTCCCAGGCATCTGGGAGGATTTTTGCATCAT
JMFF004K13+ AGGAGCGGAGGGCGGGGCGGCCATGGAAGTCCCAGGCATCTGGGAGGATTTTTGCATCAT
                      ____________________________________________________________
consensus AGGAGCGGAGGGCGGGGCGGCCATGGAAGTCCCAGGCATCTGGGAGGATTTTTGCATCAT
 
. : . : . : . : . : . :
JMFS136F05+ TTTTTGTTTGAGGAAATGCCATTATCAACAAGCTAAGGCTAAGTTTTAATAGAGATGGAA
JMSF025I16+ TTTTTGTTTGAGGAAATGCCATTATCAACAAGCTAAGGCTAAGTTTTAATAGAGATGGAA
JMFF021L07+ TTTTTGTTTGAGGAAATGCCATTATCAACAAGCTAAGGCTAAGTTTTAATAGAGATGGAA
JMFF004K13+ TTTTTGTTTGAGGAAATGCCATTATCAACAAGCTAAGGCTAAGTTTTAATAGAGATGGAA
                      ____________________________________________________________
consensus TTTTTGTTTGAGGAAATGCCATTATCAACAAGCTAAGGCTAAGTTTTAATAGAGATGGAA
 
. : . : . : . : . : . :
JMFS136F05+ TAAGAGTGATGATATATATGGTTGAAGAAGCTCAGAAGAT
JMSF025I16+ TAAGAGTGATGATATATATGGTTGAAGAAGCTCAGAAGATAGAGACGACTTAAGTCTCAT
JMFF021L07+ TAAGAGTGATGATATATATGGTTGAAGAAGCTCAGAAGATAGAGACGACTTAAGTCTCAT
JMFF004K13+ TAAGAGTGATGATATATATGGTTGAAGAAGCTCAGAAGATAGAGACGACTTAAGTCTCAT
                      ____________________________________________________________
consensus TAAGAGTGATGATATATATGGTTGAAGAAGCTCAGAAGATAGAGACGACTTAAGTCTCAT
 
. : . : . : . : . : . :
JMFF021L07+ GCAGATTCAATTCATCCAAGCAGCCCTTTTATAATGGTGGCCTAGCTTGGGCCCGGAGAT
JMFF004K13+ GCAGATTCAATTCATCCAAGCAGCCCTTTTATAATGGTGGCCTAGCTTGGGCCCGGAGAT
                      ____________________________________________________________
consensus GCAGATTCAATTCATCCAAGCAGCCCTTTTATAATGGTGGCCTAGCTTGGGCCCGGAGAT