Previous Contig 000215:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H16Sequence531000215 (38)pir|T09560|T095604e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi743000215 (38)gb:AP001129_18208467e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P064
JMFF004K06Sequence589000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi769000215 (38)gb:AP001129_18208460.028Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P064
JMFF005B10Sequence468000215 (38)pir|T09558|T095586e-41hypothetical protein L73G19.40 - Arabidopsis thaliana>gb:ATCHRIV63_1546447 Arabi743000215 (38)
JMFF007J02Sequence530000215 (38)pir|T09560|T095604e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi743000215 (38)gb:AP001129_18208460.026Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P064
JMFF013D11Sequence563000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi743000215 (38)
JMFF024N09Sequence529000215 (38)pir|T09560|T095604e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi766000215 (38)
JMFF028D09Sequence534000215 (38)pir|T09560|T095604e-46hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMFF031B22Sequence520000215 (38)pir|T09560|T095601e-46hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi753000215 (38)
JMFF032M02Sequence539000215 (38)
JMFF044I24Sequence647000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi429000215 (38)
JMFF045G24Sequence647000215 (38)642000215 (38)
JMFF046N02Sequence502000215 (38)pir|T09560|T095608e-43hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi424000215 (38)
JMFF047M13Sequence506000215 (38)pir|T09560|T095604e-46hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi258000215 (38)
JMFN004P14Sequence642000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMFN011P19Sequence622000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMFN014A24Sequence626000215 (38)
JMFN017G15Sequence611000215 (38)gb:AE016959_10236083e-41Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMFN044F02Sequence605000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMFS027H07Sequence556000215 (38)pir|T09560|T095601e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMFS035C06Sequence627000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi
JMSF025B19Sequence637000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi719000215 (38)gb:AP001129_18208460.025Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P064
JMSF025C21Sequence650000215 (38)pir|T09560|T095602e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi712000215 (38)
JMSF030I13Sequence546000215 (38)
JMSF045P13Sequence756000215 (38)pir|T09560|T095603e-47hypothetical protein L73G19.60 - Arabidopsis thaliana>gb:ATCHRIV63_1546449 Arabi687000215 (38)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045P13- AACTTTCTTATAAGTTGGTTTTCAAGAGGTGCTGAACTTAGCTTGACTTTTGAGGGGC
                      ____________________________________________________________
consensus AACTTTCTTATAAGTTGGTTTTCAAGAGGTGCTGAACTTAGCTTGACTTTTGAGGGGC
 
. : . : . : . : . : . :
rJMSF045P13- CTCCCCAGCAATCTCCTAACCACCAGTTGATGGATCTGATCAGTCTTTGTCCAATAATCT
                      ____________________________________________________________
consensus CTCCCCAGCAATCTCCTAACCACCAGTTGATGGATCTGATCAGTCTTTGTCCAATAATCT
 
. : . : . : . : . : . :
rJMSF045P13- TCTAGTCACCAATTAATAGACTTGGCATTCTACAAGTTAAGAAATATAACAAGGAGATCT
rJMFF045G24- TATAACAAGGAGATCT
                      ____________________________________________________________
consensus TCTAGTCACCAATTAATAGACTTGGCATTCTACAAGTTAAGAAATATAACAAGGAGATCT
 
. : . : . : . : . : . :
rJMSF045P13- AGAATAGAAGAAATTAAGGCCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF032M02- AAGGCCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF045G24- AGAATAGAAGAAATTAAGGCCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF047M13- ACGTCTTAGTTTACCATACAGAAC
JMFF045G24+ AAGGCCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF024N09- CCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF031B22- GTCTTAGTTTACCATACAGAAC
rJMFF007J02- ATACAGAAC
rJMFF013D11- ATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF005B10- ATACAGAAC
JMFN014A24+ TTGATGAAGTACGTCTTAGTTTACCATACAGAAC
rJMFF004K06- ATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
                      ____________________________________________________________
consensus AGAATAGAAGAAATTAAGGCCGAGAATTGATGAAGTACGTCTTAGTTTACCATACAGAAC
 
. : . : . : . : . : . :
rJMSF045P13- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF032M02- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTANAACTCACAATCTCACACAAA
rJMFF045G24- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF046N02- ACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF047M13- AAAGGGAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF044I24- ACTACCCACATCCTGAAATCCATAACTAAAACTCCCAATCTCCCCCAAA
JMFF045G24+ AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF024N09- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF031B22- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF007J02- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF013D11- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF005B10- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMSF030I13- CACATCCTGACATCCGTAACTAACACTCACAATCTCACACAAA
JMFN014A24+ AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF004K06- AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMSF025B19- ACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
rJMSF025C21- GACATCCATAACTAAAACTCACAATCTCACACAAA
rJMFF001H16- TACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
                      ____________________________________________________________
consensus AAAGGTAGTAGACTACACACATCCTGACATCCATAACTAAAACTCACAATCTCACACAAA
 
. : . : . : . : . : . :
rJMSF045P13- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF032M02- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF045G24- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF046N02- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF047M13- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF044I24- TACCCAGAAAACTAACTTTGAACAAACCGCCCCCCGCCTATAAGCTTAACTTGGTCGGGG
JMFF045G24+ TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF024N09- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF031B22- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGT
rJMFF007J02- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF013D11- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF005B10- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMSF030I13- TACANAGAATACTAACTTTGAACANACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
JMFN014A24+ TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMFF004K06- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMSF025B19- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
rJMSF025C21- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCGGGC
rJMFF001H16- TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
                      ____________________________________________________________
consensus TACACAGAATACTAACTTTGAACAAACAGCACACAGCCTATAAGCTTAACTTGATCTGGC
 
. : . : . : . : . : . :
rJMSF045P13- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF032M02- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCNACTTTTGCTGAT
rJMFF045G24- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF046N02- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF047M13- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF044I24- TTGGATTATTCTTAATTTAAGCTGCAAAAATGGGGTTCATTGCCCTCAACTTTTGGTGAA
JMFF045G24+ TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF024N09- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF031B22- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF007J02- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF013D11- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF005B10- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMSF030I13- TTGGATTATTCTTAATTTANGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAN
JMFN014A24+ TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF004K06- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMSF025B19- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMSF025C21- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
rJMFF001H16- TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
                      ____________________________________________________________
consensus TTGGATTATTCTTAATTTAAGCTGCAGATATGGGTTTCATTGCCTTCAACTTTTGCTGAT
 
. : . : . : . : . : . :
rJMSF045P13- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF032M02- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF045G24- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF046N02- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF047M13- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTG
rJMFF044I24- TATTCTTCAAGACGGGGGGTTCGTCTTCGGAAACCGAAAATTCTTCTTCCTCTGAAATTG
JMFF045G24+ TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF024N09- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF031B22- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF007J02- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF013D11- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF005B10- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMSF030I13- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGANATNG
JMFN014A24+ TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF004K06- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMSF025B19- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMSF025C21- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
rJMFF001H16- TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
                      ____________________________________________________________
consensus TATTCTTCATGACTGGGGTTTCGTCTTCGGAATCCGAATATTCTTCTTCATCTGATATTG
 
. : . : . : . : . : . :
rJMSF045P13- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF032M02- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF045G24- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF046N02- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF044I24- GCCCCCCCACAAGGGGGTCCGGCGGGGGGTGCTTCTTCCCCCCTTTAAAATCATCAGTTT
JMFF045G24+ GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF024N09- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF031B22- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF007J02- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF013D11- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF005B10- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMSF030I13- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAANCATCAGTTT
JMFN014A24+ GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF004K06- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMSF025B19- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMSF025C21- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
rJMFF001H16- GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
                      ____________________________________________________________
consensus GCTCCTCCACAATGGGTTCCGTCGTGTGCTGCTTCTTCCCCCCTTTAGAATCATCAGTTT
 
. : . : . : . : . : . :
rJMSF045P13- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF032M02- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF045G24- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF046N02- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGA
rJMFF044I24- GGGATTCCGAGCCATCTTCAATAAAAAAACAGGGTGGCGCTGCTGGA
JMFF045G24+ GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF024N09- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF031B22- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF007J02- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF013D11- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF005B10- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMSF030I13- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTNTGTCN
JMFN014A24+ GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF004K06- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMSF025B19- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMSF025C21- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
rJMFF001H16- GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
                      ____________________________________________________________
consensus GCGATTCCGAGCCATCTTCAATAAGAAGACAGGCTGGCGCTGCTGGAAGCTGCTTTGTCT
 
. : . : . : . : . : . :
rJMSF045P13- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF032M02- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGNTG
rJMFF045G24- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCC-GCACCTTTTTCAGTTG
JMFF045G24+ TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCC-GCACCTTTTTCAGTTG
rJMFF024N09- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF031B22- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF007J02- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF013D11- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF005B10- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMSF030I13- TCTCTTCNTCNTCTAAATATTTTGGCTCANCGGAATCNTGGCCGGCACCTTTTTCAGTTG
JMFN014A24+ TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMFF004K06- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMSF025B19- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
rJMSF025C21- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACC-TTTTCAGTTG
rJMFF001H16- TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
                      ____________________________________________________________
consensus TCTCTTCTTCTTCTAAATATTTTGGCTCATCGGAATCCTGGCCGGCACCTTTTTCAGTTG
 
. : . : . : . : . : . :
rJMSF045P13- CCTTCTTCTCGTCTTCCGGTTCCACGTTT
rJMFF032M02- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF045G24- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
JMFF045G24+ CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF024N09- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF031B22- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF007J02- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF013D11- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF005B10- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMSF030I13- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGGCAAGGGCGATCACCGGAG
JMFN014A24+ CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF004K06- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMSF025B19- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMSF025C21- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
rJMFF001H16- CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
JMFN017G15+ TCACCGGAG
JMSF045P13+ TTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
                      ____________________________________________________________
consensus CCTTCTTCTCGTCTTCCGGTTCCACGTTTACCGGCTTGTCGTCAAGGGCGATCACCGGAG
 
. : . : . : . : . : . :
rJMFF032M02- CATTAACCCGG
rJMFF045G24- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
JMFF045G24+ CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF024N09- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF031B22- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF007J02- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF013D11- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF005B10- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMSF030I13- CATTAACCNGGAAGGTTTTGGTGATGNTCTTCACCCCAATTNCGATTATCGGCAGGNTTT
JMFN014A24+ CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF004K06- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMSF025B19- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMSF025C21- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
rJMFF001H16- CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
JMFN004P14+ GCAGGTTTT
JMFN017G15+ CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
JMSF045P13+ CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
                      ____________________________________________________________
consensus CATTAACCCGGAAGGTTTTGGTGATGCTCTTCACCCCAATTCCGATTATCGGCAGGTTTT
 
. : . : . : . : . : . :
rJMFF045G24- CGAT
JMFF045G24+ CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTG
rJMFF024N09- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMFF031B22- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMFF007J02- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMFF013D11- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMFF005B10- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMSF030I13- CGATNTGGGATTTGGATTTTGAG
JMFN014A24+ CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTA
rJMFF004K06- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMSF025B19- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
rJMSF025C21- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTT--AAAATGAGGAACTAGATGACCTGG
rJMFF001H16- CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMSF025B19+ TTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMFN011P19+ GAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMFN044F02+ TAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMFF044I24+ GGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMFS035C06+ GATTTGGGATTTGGATT-TGAGTTCTTAGACTTAAAAATTGAGGAACTAGATGACCTGG
JMFN004P14+ CGATTTGGGATTTGGATTNTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMSF025C21+ TTTGGGATTTGGATTTTGAGTTCTTAGACTT--AAAATGAGGAACTAGATGACCTGG
JMFN017G15+ CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
JMSF045P13+ CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
                      ____________________________________________________________
consensus CGATTTGGGATTTGGATTTTGAGTTCTTAGACTTAAAAAATGAGGAACTAGATGACCTGG
 
. : . : . : . : . : . :
rJMFF024N09- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF031B22- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF007J02- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF013D11- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF005B10- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF004K06- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMSF025B19- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMSF025C21- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
rJMFF001H16- GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMSF025B19+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFN011P19+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFN044F02+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFF044I24+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFS035C06+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFN004P14+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMSF025C21+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFN017G15+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMSF045P13+ GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFF013D11+ TGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFS027H07+ GCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
JMFF004K06+ CGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
                      ____________________________________________________________
consensus GCTGCGAATCCGAATCAGCGGCGCCGACGCCTGTAGCGCTTTTGAGGAGTTTAAACACGT
 
. : . : . : . : . : . :
rJMFF024N09- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTANCAGCATCGCCGACGTTAGCC
rJMFF031B22- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMFF007J02- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMFF013D11- CTTTGGGTGCTTGCTTCAGCTT-GNTACCGACGTCCTTAGCAGCATCGC
rJMFF005B10- CTTTGGGTGCTTGCTTCAGCTTGGTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMFF004K06- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMSF025B19- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMSF025C21- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
rJMFF001H16- CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMSF025B19+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFN011P19+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFN044F02+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF044I24+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFS035C06+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFN004P14+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMSF025C21+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFN017G15+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMSF045P13+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF013D11+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFS027H07+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF007J02+ GGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF024N09+ GGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF031B22+ CTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF047M13+ GACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF001H16+ TGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF046N02+ AGCAGCATCGCCGACGTTAGCC
JMFF028D09+ GGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
JMFF004K06+ CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
                      ____________________________________________________________
consensus CTTTGGGTGCTTGCTTCAGCTT-GTTACCGACGTCCTTAGCAGCATCGCCGACGTTAGCC
 
. : . : . : . : . : . :
rJMFF024N09- AACCGG
rJMFF031B22- AACCGGTTGGCC
rJMFF007J02- AACCGGTTGGCCCAG
rJMFF005B10- AACCGGTTGGCCCA
rJMFF004K06- AACCGGTTGGCCCAG
rJMSF025B19- AACCGGTTGGCCCAGG
rJMSF025C21- AACCGGTTGGCC
rJMFF001H16- AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGA
JMSF025B19+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFN011P19+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFN044F02+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF044I24+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFS035C06+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFN004P14+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMSF025C21+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFN017G15+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMSF045P13+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF013D11+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFS027H07+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF007J02+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF024N09+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF031B22+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF047M13+ AACCGGTGGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF001H16+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF046N02+ AACCGGTGGCCCNAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF028D09+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF005B10+ CAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
JMFF004K06+ AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
                      ____________________________________________________________
consensus AACCGGTTGGCCCAGGCAGGGAGCTTGGGAACTCCGAGCTTCTCCAACAGCTCCTGGCAG
 
. : . : . : . : . : . :
JMSF025B19+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFN011P19+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFN044F02+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF044I24+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFS035C06+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFN004P14+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMSF025C21+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFN017G15+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMSF045P13+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF013D11+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFS027H07+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF007J02+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF024N09+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF031B22+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF047M13+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF001H16+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF046N02+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTAGTCCCGGAGC
JMFF028D09+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTAGTCCCGGAGC
JMFF005B10+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
JMFF004K06+ AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
                      ____________________________________________________________
consensus AAGTGCTTGGAGTTTCTGGAAACCAAGCTGTACTCGTCGCCGGGCCACTCGTCCCGGAGC
 
. : . : . : . : . : . :
JMSF025B19+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFN011P19+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFN044F02+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF044I24+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFS035C06+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFN004P14+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMSF025C21+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFN017G15+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMSF045P13+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF013D11+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFS027H07+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF007J02+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF024N09+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF031B22+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF047M13+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF001H16+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF046N02+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF028D09+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF005B10+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
JMFF004K06+ TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
                      ____________________________________________________________
consensus TCCTTGAGGATGAGATTGACCTTAGAGGAAGAACAGTGGGTCCTACCGGCGGGGATGCTT
 
. : . : . : . : . : . :
JMSF025B19+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFN011P19+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFN044F02+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF044I24+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFS035C06+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFN004P14+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMSF025C21+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFN017G15+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMSF045P13+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF013D11+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFS027H07+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF007J02+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF024N09+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF031B22+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF047M13+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF001H16+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF046N02+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF028D09+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF005B10+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
JMFF004K06+ TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
                      ____________________________________________________________
consensus TCCCGGTAGGTGTAGTTTGGGTTCTTGGTCGCCGGGCAGCTGAAGATACCGCTGCCCTTG
 
. : . : . : . : . : . :
JMSF025B19+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFN011P19+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFN044F02+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF044I24+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFS035C06+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFN004P14+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMSF025C21+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFN017G15+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMSF045P13+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF013D11+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFS027H07+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF007J02+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF024N09+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCATAGATTTGGACGGCGACGTGGAAGACG
JMFF031B22+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF047M13+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF001H16+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF046N02+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF028D09+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF005B10+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
JMFF004K06+ TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
                      ____________________________________________________________
consensus TCGCGGTGGCCGTACGCCCATTCCACTTCGCCGTAGATTTGGACGGCGACGTGGAAGACG
 
. : . : . : . : . : . :
JMSF025B19+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFN011P19+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFN044F02+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF044I24+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFS035C06+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFN004P14+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMSF025C21+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFN017G15+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMSF045P13+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF013D11+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFS027H07+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF007J02+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF024N09+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF031B22+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF047M13+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF001H16+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF046N02+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF028D09+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF005B10+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
JMFF004K06+ CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
                      ____________________________________________________________
consensus CCACCGAGATTGATACCGTCTTTGAGGAGCTTGTTCATCTGGACCACCATGTAGTTCACG
 
. : . : . : . : . : . :
JMSF025B19+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFN011P19+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFN044F02+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF044I24+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFS035C06+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFN004P14+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMSF025C21+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFN017G15+ GTG
JMSF045P13+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF013D11+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFS027H07+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF007J02+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF024N09+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF031B22+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF047M13+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF001H16+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF046N02+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF028D09+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF005B10+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
JMFF004K06+ GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
                      ____________________________________________________________
consensus GTGTCGTTCCCTTTTCCGCTCATGGTTAGGTCGTAGATATGGAGGATAACTTCTGTCATC
 
. : . : . : . : . : . :
JMSF025B19+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGT
JMFN011P19+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAG
JMFN044F02+ TTGCTAATGAATATGGTGGATGCCAATAATTCA
JMFF044I24+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTT
JMFS035C06+ TTGCTAATGAATATGGTGGATGCCAATAAT
JMFN004P14+ TTGCTAATGAATATGGTGGATGCCAATAATTCAG
JMSF025C21+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGT
JMSF045P13+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTT
JMFF013D11+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTT
JMFS027H07+ TTGCTAATGAATATGGTGGATGCCAATAATTCAG
JMFF007J02+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCCATGTT
JMFF024N09+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTAT
JMFF031B22+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCT
JMFF047M13+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTT
JMFF001H16+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTT
JMFF046N02+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTTGCTCC
JMFF028D09+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTTGCTCC
JMFF005B10+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTTGCTCC
JMFF004K06+ TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTTGCTCC
                      ____________________________________________________________
consensus TTGCTAATGAATATGGTGGATGCCAATAATTCAGTATGTTGAGGCAATCTATGTTGCTCC