Previous Contig 000213:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K03Sequence537000213 (4)gb:ATAC010676_15431348e-29Arabidopsis thaliana chromosome III BAC T22N4 genomic sequence, complete sequenc706009908 (3)pir|T51439|T514391e-69oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442
JMFF017C24Sequence546000213 (4)pir|T51439|T514392e-50oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442 748009908 (3)pir|T51439|T514391e-68oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442
JMFF036H07Sequence551000213 (4)pir|T51439|T514391e-51oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442 699009908 (3)pir|T51439|T514398e-59oligopeptide transporter-like protein - Arabidopsis thaliana>gb:ATF2G14_1550442
JMFF050M04Sequence587000213 (4)gb:ATAC010676_15431345e-29Arabidopsis thaliana chromosome III BAC T22N4 genomic sequence, complete sequenc412021909gb:AP004994_18469272e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036H07+ GTCCTGGATATACGACAAGACTGAGACTCC
JMFF017C24+ GGATATACGACAAGACTGAGACTCC
                      ____________________________________________________________
consensus GTCCTGGATATACGACAAGACTGAGACTCC
 
. : . : . : . : . : . :
JMFF036H07+ CAGAAGACTGCCGCAGCAAATGCCGAAATACCACCACTGGAAGAACAAACTCTTCTTGAC
JMFF017C24+ CAGAAGACTGCCGCAGCAAATGCCGAAATACCACCACTGGAAGAACAAACTCTTCTTGAC
                      ____________________________________________________________
consensus CAGAAGACTGCCGCAGCAAATGCCGAAATACCACCACTGGAAGAACAAACTCTTCTTGAC
 
. : . : . : . : . : . :
JMFF036H07+ GGAGCTCTTGTCGCCGTTCTTGGTTGACGGCAGCTCGCCGTCGTCTTCATCTCCAAGCTG
JMFF017C24+ GGAGCTCTTGTCGCCGTTCTTGGTTGACGGCAGCTCGCCGTCGTCTTCATCTCCAAGCTG
                      ____________________________________________________________
consensus GGAGCTCTTGTCGCCGTTCTTGGTTGACGGCAGCTCGCCGTCGTCTTCATCTCCAAGCTG
 
. : . : . : . : . : . :
JMFF036H07+ ATCCGCCGCGAAGGCCTGCAAGGATGGGTTGTAGCCACCCAGGCCCAGTGAAATTAAGTG
JMFF017C24+ ATCCGCCGCGAAGGCCTGCAAGGATGGGTTGTAGCCACCCAGGCCCAGTGAAATTAAGTG
JMFF050M04+ G
                      ____________________________________________________________
consensus ATCCGCCGCGAAGGCCTGCAAGGATGGGTTGTAGCCACCCAGGCCCAGTGAAATTAAGTG
 
. : . : . : . : . : . :
JMFF036H07+ GAGCGGCCATGAGAGGGAAGAAGAGCTAATTTTCTGGGCATTATTACTCCCCGGCGGCCA
JMFF017C24+ GAGCGGCCATGAGAGGGAAGAAGAGCTAATTTTCTGGGCATTATTACTCCCCGGCGGCCA
JMFF050M04+ GAGCGGCCATGAGAGGGAAGAAGAGCTAATNTTCTGGGCA-TATTACTCCCCGGCGGCCA
                      ____________________________________________________________
consensus GAGCGGCCATGAGAGGGAAGAAGAGCTAATTTTCTGGGCATTATTACTCCCCGGCGGCCA
 
. : . : . : . : . : . :
JMFF036H07+ CCCCATCGCCGTTGATGTCAACGCTATCAGCCCCAGAATATAGAAAAATGCAGAGCCTAA
JMFF017C24+ CCCCATCGCCGTTGATGTCAACGCTATCAGCCCCAGAATATAGAAAAATGCAGAGCCTAA
JMFF050M04+ CCCCATCGCCGTTGATGTCAACGCTATCAGCCCCAGAATATAGAAAAATGCAGAGCCTAA
JMFF004K03+ CATCGCCGTTGATGTCAACGCTATCAGCCCCAGAATATAGAAAAATGCAGAGCCTAA
                      ____________________________________________________________
consensus CCCCATCGCCGTTGATGTCAACGCTATCAGCCCCAGAATATAGAAAAATGCAGAGCCTAA
 
. : . : . : . : . : . :
JMFF036H07+ AATAGTTGAATAGCTATCCAAGTAAGAGTCGGCCAACGGCGCCACCAGCAGCGGCACCAT
JMFF017C24+ AATAGTTGAATAGCTATCCAAGTAAGAGTCGGCCAACGGCGCCACCAGCAGCGGCACCAT
JMFF050M04+ AATAGTTGAATAGCTATCCAAGTAAGAGTCGGCCAACGGCGCCACCAGCAGCGGCACCAT
JMFF004K03+ AATAGTTGAATAGCTATCCAAGTAAGAGTCGGCCAACGGCGCCACCAGCAGCGGCACCAT
                      ____________________________________________________________
consensus AATAGTTGAATAGCTATCCAAGTAAGAGTCGGCCAACGGCGCCACCAGCAGCGGCACCAT
 
. : . : . : . : . : . :
JMFF036H07+ AGAGGTGAAGCCACACCAATTGTTGACCAGCTTCGCCGCCGACGAGTTGCTCATCTTCGC
JMFF017C24+ AGAGGTGAAGCCACACCAATTGTTGACCAGCTTCGCCGCCGACGAGTTGCTCATCTTCGC
JMFF050M04+ AGAGGTGAAGCCACACCAATTGTTGACCAGCTTCGCCGCCGACGAGTTGCTCATCTTCGC
JMFF004K03+ AGAGGTGAAGCCACACCAATTGTTGACCAGCTTCGCCGCCGACGAGTTGCTCATCTTCGC
                      ____________________________________________________________
consensus AGAGGTGAAGCCACACCAATTGTTGACCAGCTTCGCCGCCGACGAGTTGCTCATCTTCGC
 
. : . : . : . : . : . :
JMFF036H07+ CACATCCGTGAGATACGTCACCAAATTCGCCGCCACGCCTTTGAACGTGAACCTCTCCAT
JMFF017C24+ CACATCCGTGAGATACGTCACCAAATTCGCCGCCACGCCTTTGAACGTGAACCTCTCCAT
JMFF050M04+ CACATCCGTGAGATACGTCACCAAATTCGCCGCCACGCCTTTGAACGTGAACCTCTCCAT
JMFF004K03+ CACATCCGTGAGATACGTCACCAAATTCGCCGCCACGCCTTTGAACGTGAACCTATCCAT
                      ____________________________________________________________
consensus CACATCCGTGAGATACGTCACCAAATTCGCCGCCACGCCTTTGAACGTGAACCTCTCCAT
 
. : . : . : . : . : . :
JMFF036H07+ CCCCGCTATCACTATGAGGAGAATGCATGGCTTGTTAAGAC
JMFF017C24+ CCCCGCTATCACTATGAGGAGAATGCATGGCTTGTTAAGAC
JMFF050M04+ CCCCGCTATCACTATGAGGAGAATGCATGGCTTGTTCAGACCTTGCCCGCCCGCCATGGC
JMFF004K03+ CCCCGCTATCACTATGAGGAGAATGCATGGCTTGTTCAGACCTTGCCCGCCCGCCATGGC
                      ____________________________________________________________
consensus CCCCGCTATCACTATGAGGAGAATGCATGGCTTGTTCAGACCTTGCCCGCCCGCCATGGC
 
. : . : . : . : . : . :
JMFF050M04+ TAGCTACAACGTACTAGATCAGAACGAAGATGGAGTAATAATGAACAGAAACCTGAGATT
JMFF004K03+ TAGCTACAACGTACTAGATCAGAACGAAGATGGAGTAATAATGAACAGAAACCTGAGATT
                      ____________________________________________________________
consensus TAGCTACAACGTACTAGATCAGAACGAAGATGGAGTAATAATGAACAGAAACCTGAGATT
 
. : . : . : . : . : . :
JMFF050M04+ CATATAATAATATATTTAATTAATTAGCCATTGAAGCACCAATAAGGTGGGGATGGGGGC
JMFF004K03+ CATATAATAATATATTTAATTAATTAGCCATTGAAGCACCAATAAGGTGGGGATGGGGGC
                      ____________________________________________________________
consensus CATATAATAATATATTTAATTAATTAGCCATTGAAGCACCAATAAGGTGGGGATGGGGGC
 
. : . : . : . : . : . :
JMFF050M04+ ACTGCTCTACTTGACCAAGATTCTATATCATGGCCGCCTCTTTGCTAGCTTTTACAAATT
JMFF004K03+ ACTGCTCTACTTGACCAAGATTCTATATCATGGCCGCCTCTTTGCTAGCTTTTACAAATT
                      ____________________________________________________________
consensus ACTGCTCTACTTGACCAAGATTCTATATCATGGCCGCCTCTTTGCTAGCTTTTACAAATT
 
. : . : . : . : . : . :
JMFF050M04+ GTAGTGGAACACTGGACAATCACTCATCTGCTTGCTTTTCCAAAGT
JMFF004K03+ GTAGTGGAACACTGGACAATCACTCATCTGCTTGCTTTTCCAAAGTAAATTGTGACACAT
                      ____________________________________________________________
consensus GTAGTGGAACACTGGACAATCACTCATCTGCTTGCTTTTCCAAAGTAAATTGTGACACAT