Previous Contig 000203:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004H06Sequence542000203 (2)gb:AY652864_16201842e-07Populus balsamifera subsp. trichocarpa glutathione S-transferase (GST180) gene, 675009475 (5)sp|Q03662|GTX1_TOBAC3e-35Probable glutathione S-transferase (EC 2.5.1.18) (Auxin-induced protein PGNT1/PC
JMFF026O11Sequence541000203 (2)gb:AY652864_16201842e-07Populus balsamifera subsp. trichocarpa glutathione S-transferase (GST180) gene, 680009475 (5)sp|Q03662|GTX1_TOBAC1e-33Probable glutathione S-transferase (EC 2.5.1.18) (Auxin-induced protein PGNT1/PC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF026O11+ G
JMFF004H06+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
JMFF026O11+ TTGTATGAACAGATCTTGTTGTATGAATTCATATTCAACAACTTTGAGTTTGAGAGCAAT
JMFF004H06+ TTGTATGAACAGATCTTGTTGTATGAATTCATATTCAACAACTTTGAGTTTGAGAGCAAT
                      ____________________________________________________________
consensus TTGTATGAACAGATCTTGTTGTATGAATTCATATTCAACAACTTTGAGTTTGAGAGCAAT
 
. : . : . : . : . : . :
JMFF026O11+ CTCAACAGCTGCGCTAAAAGGGCTTATCCAACTACCTAGAACCTTCACTTCTGCCATTAT
JMFF004H06+ CTCAACAGCTGCGCTAAAAGGGCTTATCCAACTACCTAGAACCTTCACTTCTGCCATTAT
                      ____________________________________________________________
consensus CTCAACAGCTGCGCTAAAAGGGCTTATCCAACTACCTAGAACCTTCACTTCTGCCATTAT
 
. : . : . : . : . : . :
JMFF026O11+ CTCTCAACTTTTGCTTCTTCAATTCTGTGTTAACTGCCAACAGCACTACCACTCTACCAG
JMFF004H06+ CTCTCAACTTTTGCTTCTTCAATTCTGTGTTAACTGCCAACAGCACTACCACTCTACCAG
                      ____________________________________________________________
consensus CTCTCAACTTTTGCTTCTTCAATTCTGTGTTAACTGCCAACAGCACTACCACTCTACCAG
 
. : . : . : . : . : . :
JMFF026O11+ TACAATTCACACTGTACAGAGCATTGAAGGCGTGAAGCAGTCTACTGAGCAGAGTAGAAG
JMFF004H06+ TACAATTCACACTGTACAGAGCATTGAAGGCGTGAAGCAGTCTACTGAGCAGAGTAGAAG
                      ____________________________________________________________
consensus TACAATTCACACTGTACAGAGCATTGAAGGCGTGAAGCAGTCTACTGAGCAGAGTAGAAG
 
. : . : . : . : . : . :
JMFF026O11+ ATGGCCGTCCGCCCGTCCAGGTCTCCGGTCGCGGCTCCAGTAGGAAGTAGCAGATGTAGC
JMFF004H06+ ATGGCCGTCCGCCCGTCCAGGTCTCCGGTCGCGGCTCCAGTAGGAAGTAGCAGATGTAGC
                      ____________________________________________________________
consensus ATGGCCGTCCGCCCGTCCAGGTCTCCGGTCGCGGCTCCAGTAGGAAGTAGCAGATGTAGC
 
. : . : . : . : . : . :
JMFF026O11+ ACACTAGCTCCGGTGGCGTCATCCGTGATCGTCCGTCGGCGAGGACTGGAGGAGGGAGGA
JMFF004H06+ ACACTAGCTCCGGTGGCGTCATCCGTGATCGTCCGTCGGCGAGGACTGGAGGAGGGAGGA
                      ____________________________________________________________
consensus ACACTAGCTCCGGTGGCGTCATCCGTGATCGTCCGTCGGCGAGGACTGGAGGAGGGAGGA
 
. : . : . : . : . : . :
JMFF026O11+ GCGGTCAGCGGTGGTCCACTGGTCCAGCCGTCCAGGTCGCGGCTCGCGAGGAGCGGTGGG
JMFF004H06+ GCGGTCAGCGGTGGTCCACTGGTCCAGCCGTCCAGGTCGCGGCTCGCGAGGAGCGGTGGG
                      ____________________________________________________________
consensus GCGGTCAGCGGTGGTCCACTGGTCCAGCCGTCCAGGTCGCGGCTCGCGAGGAGCGGTGGG
 
. : . : . : . : . : . :
JMFF026O11+ CGGTGGCGTCGTCCGGCGTCTTCCGTCGGCCGAGGCGCTGAGGCGGCGAGGACTGGCGTC
JMFF004H06+ CGGTGGCGTCGTCCGGCGTCTTCCGTCGGCCGAGGCGCTGAGGCGGCGAGGACTGGCGTC
                      ____________________________________________________________
consensus CGGTGGCGTCGTCCGGCGTCTTCCGTCGGCCGAGGCGCTGAGGCGGCGAGGACTGGCGTC
 
. : . : . : . : . : . :
JMFF026O11+ GTCCGGTGTCTCTCTGACTCTCTCTGTCGACTGTCTCTCTGAAGAAGTGAAGAGTGAGGA
JMFF004H06+ GTCCGGTGTCTCTCTGACTCTCTCTGTCGACTGTCTCTCTGAAGAAGTGAAGAGTGAGGA
                      ____________________________________________________________
consensus GTCCGGTGTCTCTCTGACTCTCTCTGTCGACTGTCTCTCTGAAGAAGTGAAGAGTGAGGA