Previous Contig 000198:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G17Sequence577000198 (5)pir|A96828|A968282e-16hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895666008685 (5)
JMFF010P18Sequence544000198 (5)pir|A96828|A968281e-32hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895798008685 (5)pir|A96828|A968282e-12hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF022E23Sequence707000198 (5)pir|A96828|A968286e-62hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895123008685 (5)
JMSF025A16Sequence676000198 (5)pir|A96828|A968281e-43hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895772008685 (5)pir|A96828|A968289e-12hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF028I24Sequence482000198 (5)pir|A96828|A968283e-27hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895657008685 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022E23+ GGCGTAAACTTTCTCGTATCATGATTCCTA
                      ____________________________________________________________
consensus GGCGTAAACTTTCTCGTATCATGATTCCTA
 
. : . : . : . : . : . :
JMSF022E23+ CCAAAACAACTAGAGAAGGCGGCATACTCAGAATTCCAAACACTCCCTTTGATCCGATTA
                      ____________________________________________________________
consensus CCAAAACAACTAGAGAAGGCGGCATACTCAGAATTCCAAACACTCCCTTTGATCCGATTA
 
. : . : . : . : . : . :
JMSF022E23+ GATGAACTAAAAAGCCACTGATCATATACCCAATTAGTTGTCCAACCGAAGAGCTCCCTC
JMSF025A16+ CCACTGATCATATACCCAATTAGNTGTCCAACCGAAGAGCTCCCTC
                      ____________________________________________________________
consensus GATGAACTAAAAAGCCACTGATCATATACCCAATTAGTTGTCCAACCGAAGAGCTCCCTC
 
. : . : . : . : . : . :
JMSF022E23+ CGCATAAGCTTTGCATGTCACCAGCCAGAGACGGATGGCTTATGCTGTTCTCGGTTACAC
JMSF025A16+ CGCATAAGCTTTGCATGTCACCAGCCAGAGACGGATGGCTTATGCTGTTCTCGGTTACAC
                      ____________________________________________________________
consensus CGCATAAGCTTTGCATGTCACCAGCCAGAGACGGATGGCTTATGCTGTTCTCGGTTACAC
 
. : . : . : . : . : . :
JMSF022E23+ AGGCATCGATAATCACATCCGCTATTGCAACCCCAGCACTGCCAGCCATTAAGCATAACA
JMSF025A16+ AGGCATCGATAATCACATCCGCTATTGCAACCCCAGCACTGCCAGCCATTAAGCATAACA
                      ____________________________________________________________
consensus AGGCATCGATAATCACATCCGCTATTGCAACCCCAGCACTGCCAGCCATTAAGCATAACA
 
. : . : . : . : . : . :
JMSF022E23+ AAGCAAGTTCGATCCGTAATTGGTTCATCGATAGGGTAAGCATGGCAATGACACCGAGGG
JMSF025A16+ AAGCAAGTTCGATCCGTAATTGGTTCATCGATAGGGTAAGCATGGCAATGACACCGAGGG
                      ____________________________________________________________
consensus AAGCAAGTTCGATCCGTAATTGGTTCATCGATAGGGTAAGCATGGCAATGACACCGAGGG
 
. : . : . : . : . : . :
JMSF022E23+ AACCAGCAAGAATGAAGTAAGGCCTTCTTCTATATCCAGCAATGGGAAGAACATCAGTAA
JMSF025A16+ AACCAGCAAGAATGAAGTAAGGCCTTCTTCTATATCCAGCAATGGGAAGAACATCAGTAA
JMFF010P18+ ACCAGCAAGAATGAAGTAAGGCCTTCTTCTATATCCAGCAATGGGAAGAACATCAGTAA
JMSF028I24+ TATATCCAGCAATGGGAAGAACATCAGTAA
                      ____________________________________________________________
consensus AACCAGCAAGAATGAAGTAAGGCCTTCTTCTATATCCAGCAATGGGAAGAACATCAGTAA
 
. : . : . : . : . : . :
JMSF022E23+ GCAAACCCCAGAGAGGCTTAACAATCCAAGGGAGAGATATAATTCCAGTAAAAATCTGAG
JMSF025A16+ GCAAACCCCAGAGAGGCTTAACAATCCAAGGGAGAGATATAATTCCAGTAAAAATCTGAG
JMFF010P18+ GCAAACCCCAGAGAGGCTTAACAATCCAAGGGAGAGATATAATTCCAGTAAAAATCTGAG
JMSF028I24+ GCAAACCCCAGAGAGGCTTAACAATCCANGGGAGAGATATAATTCCAGTAAAAATNTGAG
JMFF004G17+ ATCCAAGGGAGAGATATAATTCCAGTAAAAATCTGAG
                      ____________________________________________________________
consensus GCAAACCCCAGAGAGGCTTAACAATCCAAGGGAGAGATATAATTCCAGTAAAAATCTGAG
 
. : . : . : . : . : . :
JMSF022E23+ CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCCGACTCA
JMSF025A16+ CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCCGACTCA
JMFF010P18+ CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCCGACTCA
JMSF028I24+ CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCNGACTCA
JMFF004G17+ CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCCGACTCA
                      ____________________________________________________________
consensus CTTCAGAGGGCTGTAGCTTTTGCTCATCCTTCATATAGTACTGAATACTAATCCGACTCA
 
. : . : . : . : . : . :
JMSF022E23+ AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
JMSF025A16+ AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
JMFF010P18+ AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
JMSF028I24+ AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
JMFF004G17+ AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
                      ____________________________________________________________
consensus AACCCAAACTCAACCCTTGATTGATTCCATAAACAATCACCACTGACAAAACAAAGCTCC
 
. : . : . : . : . : . :
JMSF022E23+ AATGCAGAACATCACTGAGCTTCCTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
JMSF025A16+ AATGCAGAACATCACTGAGCTTCCTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
JMFF010P18+ AATGCAGAACATCACTGAGCTTCCTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
JMSF028I24+ AATGCAGAACATCAGTGAGCTTCNTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
JMFF004G17+ AATGCAGAACATCACTGAGCTTCCTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
                      ____________________________________________________________
consensus AATGCAGAACATCACTGAGCTTCCTAAACCAATCAAACGGCCTCCACCTCCACCTCCAAG
 
. : . : . : . : . : . :
JMSF022E23+ TCCAATCATTTGACTTCCTCTCCTTCTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
JMSF025A16+ TCCAATCATTTGACTTCCTCTCCTTCTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
JMFF010P18+ TCCAATCATTTGACTTCCTCTCCTTCTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
JMSF028I24+ TCCAATCATTTGACTTCCTCTCCTTNTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
JMFF004G17+ TCCAATCATTTGACTTCCTCTCCTTCTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
                      ____________________________________________________________
consensus TCCAATCATTTGACTTCCTCTCCTTCTGGGATTGACCCTCAAGGAGAAAGGCCTCGTCTT
 
. : . : . : . : . : . :
JMSF022E23+ GGCCCATTATTCCGCC
JMSF025A16+ GGCCCATTATTCCGCCGATTCTGTTCAAGAATTGATGGAATATTAAAGACCGAATTGGGG
JMFF010P18+ GGCCCATTATTCCGCCGATTCTGTTCAAGAATTGATGGAATATTAAAGACCGAATTGGGG
JMSF028I24+ GGCCCATTATTCCGCCGATTCTGTTCAAGAATTGATGGAATATTAAAGACCGAATTGGGG
JMFF004G17+ GGCCCATTATTCCGCCGATTCTGTTCAAGAATTGATGGAATATTAAAGACCGAATTGGGG
                      ____________________________________________________________
consensus GGCCCATTATTCCGCCGATTCTGTTCAAGAATTGATGGAATATTAAAGACCGAATTGGGG
 
. : . : . : . : . : . :
JMSF025A16+ AGTAATTGAGGAAACTAAACAGAACCCATC
JMFF010P18+ AGTAATTGAGGAAACTAAACAGAACCCATCGAGATTGATCTGTTATGGAGATTAGAAAAT
JMSF028I24+ AGTAATTGAGGAAACTAANCAGAACCCATCGAGATTGATCTGTTATGGAGATTAGAAAAT
JMFF004G17+ AGTAATTGAGGAAACTAAACAGAACCCATCGAGATTGATCTGTTATGGAGATTAGAAAAT
                      ____________________________________________________________
consensus AGTAATTGAGGAAACTAAACAGAACCCATCGAGATTGATCTGTTATGGAGATTAGAAAAT
 
. : . : . : . : . : . :
JMFF010P18+ AGAAACGAGGAAAGTGAGGGGCCCGGAAAA
JMSF028I24+ AGAAACGAGGAAAGTGAGGGACCCGGAAAA
JMFF004G17+ AGAAACGAGGAAAGTGAGGGACCCGGAAAACAAGGTAGTTGGCTGCTTTGACTAACGTTA
                      ____________________________________________________________
consensus AGAAACGAGGAAAGTGAGGGACCCGGAAAACAAGGTAGTTGGCTGCTTTGACTAACGTTA
 
. : . : . : . : . : . :
JMFF004G17+ ATGACTTCTCTTCATCGTTGCAGCATTGCCTTAGTTGGTAGGCCGGTCGTGGTAGATTGG
                      ____________________________________________________________
consensus ATGACTTCTCTTCATCGTTGCAGCATTGCCTTAGTTGGTAGGCCGGTCGTGGTAGATTGG
 
. : . : . : . : . : . :
JMFF004G17+ TACCCGGGTGCCGGCCTGGTAGGTAGGCAGGCAGGCAGGCATGGATTTGGGCTAAAGCCT
                      ____________________________________________________________
consensus TACCCGGGTGCCGGCCTGGTAGGTAGGCAGGCAGGCAGGCATGGATTTGGGCTAAAGCCT