Previous Contig 000197:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G13Sequence520000197 (31)gb:ATAC009991_15431231e-35Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence620000197 (31)gb:ATAC009991_15431235e-34Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFF019D19Sequence605000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence756000197 (31)gb:ATAC009991_15431238e-37Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFF024C23Sequence526000197 (31)gb:ATAC009991_15431232e-38Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence709000197 (31)gb:ATAC009991_15431236e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFF032F21Sequence444000197 (31)gb:AB040410_15195101e-29Nicotiana tabacum NtEIG-D10 mRNA for elicitor inducible protein, complete cds.274000197 (31)gb:AB040410_15195102e-07Nicotiana tabacum NtEIG-D10 mRNA for elicitor inducible protein, complete cds.
JMFF040F16Sequence553000197 (31)gb:ATAC009991_15431233e-39Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence700000197 (31)gb:ATAC009991_15431235e-43Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFF041I19Sequence645000197 (31)gb:ATAC009991_15431232e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence563000197 (31)sp|P20144|WUN1_SOLTU2e-30Wound-induced protein 1.>pir|JQ0398|JQ0398 wun1 protein - potato>gb:A01609_14465
JMFN003H22Sequence630000197 (31)gb:ATAC009991_15431232e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN003K02Sequence626000197 (31)gb:ATAC009991_15431232e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN007L21Sequence398000197 (31)sp|P20144|WUN1_SOLTU8e-09Wound-induced protein 1.>pir|JQ0398|JQ0398 wun1 protein - potato>gb:A01609_14465
JMFN008F07Sequence653000197 (31)gb:ATAC009991_15431232e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN010A06Sequence621000197 (31)gb:ATAC009991_15431234e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN016H12Sequence577000197 (31)sp|P20144|WUN1_SOLTU2e-30Wound-induced protein 1.>pir|JQ0398|JQ0398 wun1 protein - potato>gb:A01609_14465
JMFN018H01Sequence570000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN018J09Sequence618000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN020I11Sequence612000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN028H02Sequence657000197 (31)gb:ATAC009991_15431232e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN032D19Sequence622000197 (31)gb:ATAC009991_15431233e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN034E18Sequence612000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN034N11Sequence624000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN035H22Sequence559000197 (31)gb:ATAC009991_15431233e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN038L18Sequence621000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN043B11Sequence621000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN046I06Sequence558000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMFN046N12Sequence613000197 (31)gb:ATAC009991_15431231e-44Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence
JMSF035G01Sequence645007019 (2)pir|T00827|T008276e-21hypothetical protein T13L16.1 - Arabidopsis thaliana>gb:AC006201_1533597 Arabido729000197 (31)gb:ATAC009991_15431237e-43Arabidopsis thaliana chromosome III BAC F9F8 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016H12+ AACGAAAGCAGTTATTAGCCAATCCAACAAACACGAGTTTATTGCAAACCAAACACGAG
JMFN007L21+ GCCAATCCAACAAACACGAGTTTATTGCAAACCAAACACGAG
rJMFF041I19- GCCAATCCAACAAACACGAGTTTATTGCAAACCAAACACGAG
rJMFF040F16- CGAG
rJMFF024C23- ACGAG
rJMFF004G13- ACGAG
rJMFF019D19- ACACGAGTTTATTGCAAACCAAACACGAG
                      ____________________________________________________________
consensus AACGAAAGCAGTTATTAGCCAATCCAACAAACACGAGTTTATTGCAAACCAAACACGAG
 
. : . : . : . : . : . :
JMFN016H12+ ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
JMFN007L21+ ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMFF041I19- ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMFF040F16- ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMFF024C23- ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMFF004G13- ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMFF019D19- ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
rJMSF035G01- CATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
                      ____________________________________________________________
consensus ATACATCGTACGTATCATCCGACACGCATATTGCGTGTCGTCGTCGTCGGACCATCATGG
 
. : . : . : . : . : . :
rJMFF032F21- ACGAAACA
JMFN016H12+ CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
JMFN007L21+ CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMFF041I19- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMFF040F16- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMFF024C23- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMFF004G13- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMFF019D19- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
rJMSF035G01- CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
JMFN034N11+ GTCAAACGAAACA
JMFN008F07+ CTAAAAACGTCAANCGAAACA
                      ____________________________________________________________
consensus CCGGTCGGACTCCACACGCAACGCAAACCAAAACACAAACTAAAAACGTCAAACGAAACA
 
. : . : . : . : . : . :
rJMFF032F21- GGGACGACNAATCCTAGCCGTCCATCTCACATCCTCGCATGACNCNAGATCCNACGGTGC
JMFN016H12+ GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN007L21+ GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
rJMFF041I19- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
rJMFF040F16- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
rJMFF024C23- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
rJMFF004G13- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGNGC
JMFF032F21+ TCGCA-GACGCAAGATCCGACGGTGC
rJMFF019D19- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
rJMSF035G01- GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN034N11+ GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN008F07+ GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN038L18+ AGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN010A06+ TAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN028H02+ ATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
JMFN003K02+ AGATCCGACGGTGC
JMFN034E18+ GACGGTGC
JMFN046I06+ GC
JMFF041I19+ CGCA-GACGCAAGATCCGACGGTGC
                      ____________________________________________________________
consensus GGGACGACGAATCCTAGCCGTCCATCTCACATCCTCGCA-GACGCAAGATCCGACGGTGC
 
. : . : . : . : . : . :
rJMFF032F21- CCCTTCATCCCATACNAAATAANAACNCGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN016H12+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN007L21+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
rJMFF041I19- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
rJMFF040F16- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
rJMFF024C23- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
rJMFF004G13- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFF032F21+ CCCTTCAGCCCATCCGNAATAAAAACACGCGCTTTTTATTTNTTATTTATGCGAATGGAT
rJMFF019D19- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
rJMSF035G01- CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN034N11+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN008F07+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN038L18+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN010A06+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN028H02+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTANTGGGAATGGAT
JMFN003K02+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN034E18+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN046I06+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFF041I19+ CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN032D19+ CCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN046N12+ ATAAAAACACGCGCTTTTTA-TTTTTATTATGGGGAATGGAT
JMFN003H22+ CTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN043B11+ AAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN020I11+ CACGCGCTTTTTATTTTTTATNTATGGGAATGGAT
JMFN018J09+ TAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
JMFN018H01+ AT
JMFN035H22+ GAATGGAT
JMFF019D19+ TATGGGAATGGAT
                      ____________________________________________________________
consensus CCCTTCAGCCCATACGAAATAAAAACACGCGCTTTTTATTTTTTATTTATGGGAATGGAT
 
. : . : . : . : . : . :
rJMFF032F21- CNGGTCGGGTTATATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN016H12+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN007L21+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
rJMFF041I19- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
rJMFF040F16- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
rJMFF024C23- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
rJMFF004G13- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFF032F21+ CGGGTCGGGTTAGATTGCGNGGACGAGACCCGGGNCCGATTTCCCAACCCGATTGGGGAG
rJMFF019D19- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
rJMSF035G01- CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN034N11+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN008F07+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN038L18+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN010A06+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN028H02+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN003K02+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN034E18+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN046I06+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFF041I19+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN032D19+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN046N12+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN003H22+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN043B11+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN020I11+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN018J09+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN018H01+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFN035H22+ CGGGTCGGATTAGATTGCGAGGACGAGACCCGGGGCCGATTTCCCAACCCGATTGGGGAG
JMFF019D19+ CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
JMFF040F16+ AACCCGATTGGGGAG
                      ____________________________________________________________
consensus CGGGTCGGGTTAGATTGCGAGGACGAGACCCGGGACCGATTTCCCAACCCGATTGGGGAG
 
. : . : . : . : . : . :
rJMFF032F21- GCTGCTCTCCCAGACAGAAGGGCNGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN016H12+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN007L21+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGA
rJMFF041I19- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
rJMFF040F16- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
rJMFF024C23- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
rJMFF004G13- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF032F21+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
rJMFF019D19- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
rJMSF035G01- GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN034N11+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN008F07+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN038L18+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN010A06+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN028H02+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN003K02+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN034E18+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN046I06+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF041I19+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN032D19+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN046N12+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN003H22+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN043B11+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN020I11+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN018J09+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN018H01+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFN035H22+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF024C23+ CTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF019D19+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF040F16+ GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
JMFF004G13+ AGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
                      ____________________________________________________________
consensus GCTGCTCTCCCAGACAGAAGGGCAGTGGAGGGGAGTGATAGCGGCGGCGGCGGCGGAGGC
 
. : . : . : . : . : . :
rJMFF032F21- GGAATGGTTGCC
JMFN016H12+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
rJMFF041I19- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
rJMFF040F16- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
rJMFF024C23- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
rJMFF004G13- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF032F21+ GGAATGGTTGCCGAAGCGAGTGNCGGTGAGGGAGGTGTNGAAGTACTCGCGGACCTGGGT
rJMFF019D19- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
rJMSF035G01- GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN034N11+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN008F07+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN038L18+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN010A06+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN028H02+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN003K02+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN034E18+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN046I06+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF041I19+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN032D19+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN046N12+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN003H22+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN043B11+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN020I11+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN018J09+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN018H01+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFN035H22+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF024C23+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF019D19+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF040F16+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
JMFF004G13+ GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
                      ____________________________________________________________
consensus GGAATGGTTGCCGAAGCGAGTGACGGTGAGGGAGGTGTTGAAGTACTCGCGGACCTGGGT
 
. : . : . : . : . : . :
JMFN016H12+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
rJMFF041I19- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
rJMFF040F16- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
rJMFF024C23- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
rJMFF004G13- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF032F21+ GATTATCCCATCCNTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTNG
rJMFF019D19- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
rJMSF035G01- GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN034N11+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN008F07+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN038L18+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN010A06+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN028H02+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN003K02+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN034E18+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN046I06+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF041I19+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN032D19+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN046N12+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN003H22+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN043B11+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN020I11+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN018J09+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN018H01+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFN035H22+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF024C23+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF019D19+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF040F16+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
JMFF004G13+ GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
                      ____________________________________________________________
consensus GATTATCCCATCCGTGACGGTCCAGGCGTGGACCCAGGTGATGTTGCGAGACAGGTCTTG
 
. : . : . : . : . : . :
JMFN016H12+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTT
rJMFF041I19- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGA
rJMFF040F16- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
rJMFF024C23- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
rJMFF004G13- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF032F21+ GCCCTCGACGAACNCGGTGGGGCCAATGGCGTNGACTTTGAGGGGCTCAAATCGGAAGGA
rJMFF019D19- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
rJMSF035G01- GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN034N11+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN008F07+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN038L18+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN010A06+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN028H02+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN003K02+ GCCCTCAACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN034E18+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN046I06+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF041I19+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN032D19+ GCCCTCGACGAACACGGTGGGGCCACTGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN046N12+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN003H22+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN043B11+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN020I11+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN018J09+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN018H01+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFN035H22+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF024C23+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF019D19+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF040F16+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
JMFF004G13+ GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
                      ____________________________________________________________
consensus GCCCTCGACGAACACGGTGGGGCCAATGGCGTCGACTTTGAGGGGCTCAAATCGGAAGGA
 
. : . : . : . : . : . :
rJMFF040F16- ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
rJMFF024C23- ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
rJMFF004G13- ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACNGCGGACC
JMFF032F21+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGNGGAC
rJMFF019D19- ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
rJMSF035G01- ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN034N11+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN008F07+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN038L18+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN010A06+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN028H02+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN003K02+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN034E18+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN046I06+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFF041I19+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN032D19+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN046N12+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN003H22+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN043B11+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN020I11+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN018J09+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN018H01+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFN035H22+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFF024C23+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFF019D19+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFF040F16+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
JMFF004G13+ ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
                      ____________________________________________________________
consensus ATCGCCGGCGGTTGCAGTGCCGGTGAGGATGCGCATCAAAAACTGGTGGGACGGCGGACC
 
. : . : . : . : . : . :
rJMFF040F16- ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
rJMFF024C23- ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
rJMFF004G13- ATGGAACCACCACTCT
rJMFF019D19- ATGGAACCACCACTCTAGGTCAGAAGGCCANAAGTTTCTGGACCAAATCCACGTCGCGGG
rJMSF035G01- ATGGAACCACCACTCTAGGTCAG-AGGCCANAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN034N11+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN008F07+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN038L18+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN010A06+ ATGGAACCACCACTTTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN028H02+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN003K02+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN034E18+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN046I06+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFF041I19+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN032D19+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN046N12+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN003H22+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN043B11+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN020I11+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN018J09+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN018H01+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFN035H22+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFF024C23+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFF019D19+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFF040F16+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
JMFF004G13+ ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
                      ____________________________________________________________
consensus ATGGAACCACCACTCTAGGTCAG-AGGCCAGAAGTTTCTGGACCAAATCCACGTCGC-GG
 
. : . : . : . : . : . :
rJMFF040F16- GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTG
rJMFF024C23- GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGT
rJMFF019D19- GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCANAGTT
rJMSF035G01- GAGCTCAAGGCTTCNTACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCANAGTT
JMFN034N11+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN008F07+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN038L18+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN010A06+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN028H02+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN003K02+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN034E18+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN046I06+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFF041I19+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN032D19+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN046N12+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN003H22+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN043B11+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN020I11+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN018J09+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN018H01+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFN035H22+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFF024C23+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFF019D19+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFF040F16+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
JMFF004G13+ GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
                      ____________________________________________________________
consensus GAGCTCAAGGCTTCATACAGGGCGAGCACCACCCTCTTGTTTCTGGTCTCCTCCAGAGTT
 
. : . : . : . : . : . :
rJMFF019D19- TCCTGAAT
rJMSF035G01- TCCTGAATGTTA
JMFN034N11+ TCCTGAATGTTAGC
JMFN008F07+ TCCTGAATG-TAGCCAGACCGGAAGACAGAGAGAGA
JMFN038L18+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAG
JMFN010A06+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGA
JMFN028H02+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN003K02+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN034E18+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN046I06+ TCCTGAATGTTAGCCAG
JMFF041I19+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN032D19+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN046N12+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN003H22+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN043B11+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN020I11+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN018J09+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN018H01+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFN035H22+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFF024C23+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFF019D19+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFF040F16+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
JMFF004G13+ TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
                      ____________________________________________________________
consensus TCCTGAATGTTAGCCAGACCGGAAGACAGAGAGAGAGAGAAAAAGATAGATACAGAGAGA
 
. : . : . : . : . : . :
JMFN028H02+ GAGAGAAGTG
JMFN003K02+ GAGAGAAGTGTTGT
JMFN034E18+ GAGAGA
JMFF041I19+ GAGAGAAGTGTTGTTC
JMFN032D19+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGA
JMFN046N12+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGA
JMFN003H22+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGA
JMFN043B11+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAA
JMFN020I11+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAA
JMFN018J09+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAA
JMFN018H01+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAA
JMFN035H22+ GAGAGAAGTGTTG
JMFF024C23+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAACCTTTGAGAAAAGGT
JMFF019D19+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAACCTTTGAGAAAAGGT
JMFF040F16+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAACCTTTGAGAAAAGGT
JMFF004G13+ GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAACCTTTGAGAAAAGGTGAAGAT
                      ____________________________________________________________
consensus GAGAGAAGTGTTGTTCTTATGGAGGAAGAAGAGAACAAACCTTTGAGAAAAGGTGAAGAT