Previous Contig 000192:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004F12Sequence541000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214 524000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMFF012J07Sequence479000192 (10)pir|T47741|T477418e-31copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214 521000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMFN004N08Sequence454000192 (10)gb:AP004790_18451324e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P047
JMFN006J02Sequence532000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMFN029H16Sequence429000192 (10)pir|T47741|T477417e-31copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMFS059E11Sequence520000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMFS059F10Sequence517000192 (10)pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214
JMSF031G10Sequence555019666pir|T47741|T477411e-30copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214 499000192 (10)pir|T47741|T477419e-31copper homeostasis factor [imported] - Arabidopsis thaliana>gb:ATF18O21_1549214

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS059F10+ TAAGA
JMFN004N08+ TAAGA
JMFS059E11+ CTTAAGA
JMFN006J02+ AAGA
JMFF004F12+ A
                      ____________________________________________________________
consensus CTTAAGA
 
. : . : . : . : . : . :
JMFS059F10+ ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
JMFN004N08+ ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
JMFS059E11+ ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
JMFN006J02+ ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
rJMFF012J07- TTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
rJMFF004F12- TTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
rJMSF031G10- TTACAGAAAACATCATAACAA
JMFF012J07+ AA
JMFF004F12+ ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
                      ____________________________________________________________
consensus ATCTCCAGAAATGACATTGATTTTGTAGTAATAACCATGTTACAGAAAACATCATAACAA
 
. : . : . : . : . : . :
JMFS059F10+ ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
JMFN004N08+ ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
JMFS059E11+ ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
JMFN006J02+ AATAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
rJMFF012J07- ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
rJMFF004F12- ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
rJMSF031G10- ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
JMFF012J07+ ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
JMFN029H16+ ATCAATTCTGGTACAGATACCTTCACTACAAAGCCA
JMFF004F12+ ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
                      ____________________________________________________________
consensus ACTAGGAAATATTTTTGGTTAAACATCAATTCTTGTACAGATACCTTCACTACAAAGCCA
 
. : . : . : . : . : . :
JMFS059F10+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFN004N08+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFS059E11+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFN006J02+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
rJMFF012J07- TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
rJMFF004F12- TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
rJMSF031G10- TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFF012J07+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFN029H16+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
JMFF004F12+ TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
                      ____________________________________________________________
consensus TCCAATAAGCTCATAGGCCATGAACATATATAGTTTTAAAGCTTTTAGTCGCCGCGATGG
 
. : . : . : . : . : . :
JMFS059F10+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFN004N08+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFS059E11+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFN006J02+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
rJMFF012J07- GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
rJMFF004F12- GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
rJMSF031G10- GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFF012J07+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFN029H16+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
JMFF004F12+ GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
                      ____________________________________________________________
consensus GATGATCATTATCAAGCAGCAGGAACAGCTTCCGGATTCGGCTTTGATTCAGTTCCAGCT
 
. : . : . : . : . : . :
JMFS059F10+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFN004N08+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFS059E11+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFN006J02+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
rJMFF012J07- GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
rJMFF004F12- GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
rJMSF031G10- GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFF012J07+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFN029H16+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
JMFF004F12+ GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
                      ____________________________________________________________
consensus GCTGCTGCTTCCGCTTCCCAGAACGACGTTTTCTTCCCAGTTTTTGAAACCGTCTGGAGA
 
. : . : . : . : . : . :
JMFS059F10+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFN004N08+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFS059E11+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFN006J02+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
rJMFF012J07- ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
rJMFF004F12- ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
rJMSF031G10- ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFF012J07+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFN029H16+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
JMFF004F12+ ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
                      ____________________________________________________________
consensus ACATCCTCTGGCTTCACATTACCCTTCACTGTCACTTTTTGCTCCTTCAAATCAATGTCG
 
. : . : . : . : . : . :
JMFS059F10+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
JMFN004N08+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTT-ACAGCCCCAACACAGCCCTGG
JMFS059E11+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
JMFN006J02+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
rJMFF012J07- AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
rJMFF004F12- AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
rJMSF031G10- AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
JMFF012J07+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
JMFN029H16+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
JMFF004F12+ AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
                      ____________________________________________________________
consensus AATGACTCTACACCTTCCATCTTCCCCAAAACCCTGTTGACAGCCCCAACACAGCCCTGG
 
. : . : . : . : . : . :
JMFS059F10+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
JMFN004N08+ CATGACATGCCAACCTTGAGAACAACAGTC
JMFS059E11+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
JMFN006J02+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
rJMFF012J07- CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
rJMFF004F12- CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
rJMSF031G10- CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
JMFF012J07+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
JMFN029H16+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
JMFF004F12+ CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
                      ____________________________________________________________
consensus CATGACATGCCAACCTTGAGAACAACAGTCTGAGACATGGTGACAAATCGGATTGAGAGG
 
. : . : . : . : . : . :
JMFS059F10+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTC
JMFS059E11+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTT
JMFN006J02+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGA
rJMFF012J07- AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGAT
rJMFF004F12- AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGAT
rJMSF031G10- AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGAT
JMFF012J07+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGAT
JMFN029H16+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTG
JMFF004F12+ AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGATGAT
                      ____________________________________________________________
consensus AAAAAGAAAGTGCTGAGATTTGTGTGTTTCTTGGGGGAAAGCCAATGAGAGAAGGATGAT