Previous Contig 000188:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E21Sequence489000188 (11)gb:NSU96497_16912158e-26Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin745010770 (11)gb:U96498_17266325e-63Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMFF028C23Sequence600000188 (11)gb:NSU96497_16912159e-56Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin657010770 (11)gb:U96498_17266322e-49Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMFF034C13Sequence594000188 (11)gb:NSU96497_16912151e-59Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin697010770 (11)gb:U96498_17266321e-56Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMFF047M06Sequence430000188 (11)gb:U96498_17266323e-14Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin245010770 (11)
JMFS082F08Sequence618000188 (11)gb:NSU96497_16912151e-69Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin
JMSF008I20Sequence296000188 (11)gb:U96498_17266323e-05Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin725010770 (11)gb:U96498_17266329e-64Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMSF014O09Sequence318000188 (11)gb:U96498_17266321e-10Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin669000188 (11)gb:NSU96497_16912153e-52Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin
JMSF020M20Sequence688000188 (11)gb:NSU96497_16912152e-71Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin775010770 (11)gb:U96498_17266323e-73Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMSF031N15Sequence639000188 (11)gb:NSU96497_16912154e-63Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin678010770 (11)gb:U96498_17266327e-55Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin
JMSF043D01Sequence581000188 (11)gb:NSU96497_16912153e-60Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear gene encodin740010770 (11)gb:U96498_17266322e-58Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear gene encodin

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014O09- GTTCAGAGTTCACATTGTAAAGCCATGAATCGCAATTGTAATATG
                      ____________________________________________________________
consensus GTTCAGAGTTCACATTGTAAAGCCATGAATCGCAATTGTAATATG
 
. : . : . : . : . : . :
rJMSF014O09- AATACAGAGTAAAAATGAAATAGCAAACCATCAGAATAAAGCACCAATCTTTATGAATGA
JMFF028C23+ CTCCCCAAT-GACATTGATGA
JMFF034C13+ CAAT-GACATTGATGA
JMSF043D01+ CCAAT-GACATTGATGA
JMSF031N15+ CTCATCA-ATGGCCTCCCCAAT-GACATTGATGA
                      ____________________________________________________________
consensus AATACAGAGTAAAAATGAAATAGCAACTCATCAGATTGCCTCCCCAAT-GACATTGATGA
 
. : . : . : . : . : . :
rJMSF014O09- TGAAGAAAATGAATAGGCC---AGATCACTCACAGTGATTGGAGAGCCGGTATTAAGCAC
JMFF028C23+ T-ACGCCCAAGAGTGGCCCNTACCAACAGGAACAGTGATTGGAGAGCCGGTATTAAGCAC
JMFS082F08+ ACAGTGATTGGAGAGCCGGTATTAAGCAC
JMFF034C13+ T-ACGCCCAAGAGTGGCCN-TACCAACAGGAACAGTGATTGGAGAGCCGGTATTAAGCAC
JMSF043D01+ T-ACGCCCAAGAGTGGCCC-TACCAACAGGAACAGTGATTGGAGAGCCGGTATTAAGCAC
JMSF020M20+ ACAGTGATTGGAGAGCCGGTATTAAGCAC
JMSF031N15+ T-ACGCCCAAGAGTGGCCC-TACCAACAGGAACAGTGATTGGAGAGCCGGTATTAAGCAC
                      ____________________________________________________________
consensus T-ACGCCCAAGAGTGGCCC-TACCAACAGGAACAGTGATTGGAGAGCCGGTATTAAGCAC
 
. : . : . : . : . : . :
rJMSF014O09- ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMFF028C23+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMFS082F08+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMFF034C13+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMSF043D01+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMSF020M20+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
JMSF031N15+ ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
                      ____________________________________________________________
consensus ACGTTGACCTCGCACGAGCCCTTCAGTACCGTCCATGGCGATGGTCCTAACCATATTCTC
 
. : . : . : . : . : . :
rJMSF014O09- ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMFF028C23+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMFS082F08+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMFF034C13+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMSF043D01+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMSF020M20+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMSF031N15+ ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
JMFF004E21+ CTCAAGCGC
                      ____________________________________________________________
consensus ACCCAAGTGCTGAGCCACCTCGAGAACAAGCCGGATCTGGTTGTCAAGCACCTCAAGCGC
 
. : . : . : . : . : . :
rJMSF014O09- CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMFF028C23+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMFS082F08+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMFF034C13+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMSF043D01+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMSF020M20+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMSF031N15+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
JMFF047M06+ CAATAACCTG
JMFF004E21+ CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
                      ____________________________________________________________
consensus CGTGAGGATAGGGGGCAGCCCCTCATCAAACCTCACATCAACAACGGCACCAATAACCTG
 
. : . : . : . : . : . :
rJMSF014O09- GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMFF028C23+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMFS082F08+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMFF034C13+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMSF043D01+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMSF020M20+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMSF014O09+ CCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMSF031N15+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMFF047M06+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMSF008I20+ CCTTCCCNATAGAACCGNCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
JMFF004E21+ GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
                      ____________________________________________________________
consensus GCAGACCTTCCCGATAGAACCGGCGCCAGTGAACTCATCGGTGATCTTCCCGGTGGGCTC
 
. : . : . : . : . : . :
rJMSF014O09- ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMFF028C23+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMFS082F08+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMFF034C13+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMSF043D01+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMSF020M20+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMSF014O09+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMSF031N15+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMFF047M06+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
JMSF008I20+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAANTAGAGTAACGAGC
JMFF004E21+ ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
                      ____________________________________________________________
consensus ATTTCCGGCAGGCTTAGAAGCCGGCTTATCAGCAGGGGCGGCGGAAGTAGAGTAACGAGC
 
. : . : . : . : . : . :
rJMSF014O09- GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMFF028C23+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMFS082F08+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMFF034C13+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMSF043D01+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMSF020M20+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMSF014O09+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMSF031N15+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMFF047M06+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
JMSF008I20+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGNCCTAGTTAG
JMFF004E21+ GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
                      ____________________________________________________________
consensus GAGCCGGTTCAGGAGAAATCCGGCAGGGGAGGAACGTGTAGTTGGCCGAGGCCTAGTTAG
 
. : . : . : . : . : . :
rJMSF014O09- GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMFF028C23+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMFS082F08+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMFF034C13+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMSF043D01+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMSF020M20+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMSF014O09+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMSF031N15+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMFF047M06+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMSF008I20+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
JMFF004E21+ GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
                      ____________________________________________________________
consensus GGAGTTGGCAACGGCGGATCTGGAAACGGAGCCACCCCGATGGGAGGATGATCGAAGGAT
 
. : . : . : . : . : . :
rJMSF014O09- TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMFF028C23+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMFS082F08+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMFF034C13+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMSF043D01+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMSF020M20+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMSF014O09+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMSF031N15+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMFF047M06+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
JMSF008I20+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAG
JMFF004E21+ TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
                      ____________________________________________________________
consensus TGAGGCCAGAAGCCTCCGGGAAGCCATTGAAGGGTTATGGCGTTAAACTGTGAAGACAGT
 
. : . : . : . : . : . :
rJMSF014O09- AAGAAAGAGGAGAAGGAGAGACT
JMFF028C23+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAAT
JMFS082F08+ AAGAAAGA
JMFF034C13+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAAT
JMSF043D01+ AAGAAAGAGGAGAAGGAGAGACTGC
JMSF020M20+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAATGAGAAGGGTGATGTTTATC
JMSF014O09+ AAGAAAGAGGAGAAGGAGAGACT
JMSF031N15+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAATGAGAAGGGTGATGTTTATC
JMFF047M06+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAATGAGAAGGGTGATGTTTATC
JMFF004E21+ AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAATGAGAAGGGTGATGTTTATC
                      ____________________________________________________________
consensus AAGAAAGAGGAGAAGGAGAGACTGCTAGGGTTTGAGGGAATGAGAAGGGTGATGTTTATC
 
. : . : . : . : . : . :
JMSF020M20+ T
JMSF031N15+ T
JMFF047M06+ TAGACGGTCAAAAAGAGCAGAGCGAGAGTTGTGCGTTTCGATCTCATTACTCGGCACCTT
JMFF004E21+ TAGACGGTCAAAAAGAGCAGAGCGAGAGTTGTGCGTTTCGATCTCATTACTCGGCACCTT
                      ____________________________________________________________
consensus TAGACGGTCAAAAAGAGCAGAGCGAGAGTTGTGCGTTTCGATCTCATTACTCGGCACCTT