Previous Contig 000186:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E06Sequence591000186 (4)sp|O50046|TRPB_CAMAC8e-58Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423792010996 (5)sp|O50046|TRPB_CAMACe-122Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423
JMFF013K11Sequence556000186 (4)sp|O50046|TRPB_CAMAC5e-51Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423736010996 (5)sp|O50046|TRPB_CAMACe-123Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423
JMFF050H12Sequence488000186 (4)sp|O50046|TRPB_CAMAC4e-37Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423480010996 (5)sp|O50046|TRPB_CAMAC5e-47Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423
JMSF032L09Sequence676000186 (4)sp|O50046|TRPB_CAMAC1e-74Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423720010996 (5)sp|O50046|TRPB_CAMACe-116Tryptophan synthase beta chain 2, chloroplast precursor (EC 4.2.1.20).>gb:AF0423

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032L09+ CCTGAGCACCCATATAGA
                      ____________________________________________________________
consensus CCTGAGCACCCATATAGA
 
. : . : . : . : . : . :
JMSF032L09+ TTACACATTCTAAGCCAAAGCGAGCACAAACAGTTGCAGTGGCAACACCATGCTGACCAG
                      ____________________________________________________________
consensus TTACACATTCTAAGCCAAAGCGAGCACAAACAGTTGCAGTGGCAACACCATGCTGACCAG
 
. : . : . : . : . : . :
JMSF032L09+ CTCCTGTCTCAGCTATAATGCGTTTCTTGCCCAACCGCTTTGCAAGCAAGGCTTGAGCAA
JMFF013K11+ AGCAAGGCTTGAGCAA
JMFF004E06+ CAGCTATAATGCGTTTCTTGCCCAACCGCTTTGCAAGCAAGGCTTGAGCAA
                      ____________________________________________________________
consensus CTCCTGTCTCAGCTATAATGCGTTTCTTGCCCAACCGCTTTGCAAGCAAGGCTTGAGCAA
 
. : . : . : . : . : . :
JMSF032L09+ CAGCATTATTGATTTTGTGTGCCCCAGTGTGGTTCAGATCTTCCCTCTTGAGGTAGATGA
JMFF050H12+ GTAGATGA
JMFF013K11+ CAGCATTATTGATTTTGTGTGCCCCAGTGTGGTTCAGATCTTCCCTCTTGAGGTAGATGA
JMFF004E06+ CAGCATTATTGATTTTGTGTGCCCCAGTGTGGTTCAGATCTTCCCTCTTGAGGTAGATGA
                      ____________________________________________________________
consensus CAGCATTATTGATTTTGTGTGCCCCAGTGTGGTTCAGATCTTCCCTCTTGAGGTAGATGA
 
. : . : . : . : . : . :
JMSF032L09+ GTGGTCCTTCACCATTAGGTCGCTTATAGTGCTCAGTAAGCCGTTCTGCAAAATACAGAG
JMFF050H12+ GTGGTCCTTCACCATTAGGTCGCTTATAGTGCTCAGTAAGCCGTTCTGCAAAATACAGAG
JMFF013K11+ GTGGTCCTTCACCATTAGGTCGCTTATAGTGCTCAGTAAGCCGTTCTGCAAAATACAGAG
JMFF004E06+ GTGGTCCTTCACCATTAGGTCGCTTATAGTGCTCAGTAAGCCGTTCTGCAAAATACAGAG
                      ____________________________________________________________
consensus GTGGTCCTTCACCATTAGGTCGCTTATAGTGCTCAGTAAGCCGTTCTGCAAAATACAGAG
 
. : . : . : . : . : . :
JMSF032L09+ GGCTCTCTCTCCCAACATAGTCACGCAAGATTCCATCCAGCTCTTTCTGAAAAGCGTCAT
JMFF050H12+ GGCTCTCTCTCCCAACATAGTCACGCAAGATTCCATCCAGCTCTTTCTGAAAAGCGTCAT
JMFF013K11+ GGCTCTCTCTCCCAACATAGTCACGCAAGATTCCATCCAGCTCTTTCTGAAAAGCGTCAT
JMFF004E06+ GGCTCTCTCTCCCAACATAGTCACGCAAGATTCCATCCAGCTCTTTCTGAAAAGCGTCAT
                      ____________________________________________________________
consensus GGCTCTCTCTCCCAACATAGTCACGCAAGATTCCATCCAGCTCTTTCTGAAAAGCGTCAT
 
. : . : . : . : . : . :
JMSF032L09+ CGACGGAGATGGCCTTGAACGCGGTCTCGAGCTCATCGAGAGCGTACATTAGCGTTTCGG
JMFF050H12+ CGACGGAGATGGCCTTGAACGCGGTCTCGAGCTCATCGAGAGCGTACATTAGCGTTTCGG
JMFF013K11+ CGACGGAGATGGCCTTGAACGCGGTCTCGAGCTCATCGAGAGCGTACATTAGCGTTTCGG
JMFF004E06+ CGACGGAGATGGCCTTGAACGCGGTCTCGAGCTCATCGAGAGCGTACATTAGCGTTTCGG
                      ____________________________________________________________
consensus CGACGGAGATGGCCTTGAACGCGGTCTCGAGCTCATCGAGAGCGTACATTAGCGTTTCGG
 
. : . : . : . : . : . :
JMSF032L09+ GGACATACTTCCCGCCGAACTTGCCGAACCGGCCGAACGAATCGGGGCGTTGAAGGAAAG
JMFF050H12+ GGACATACTTCCCGCCGACCTTGCCGAACCGGCCGAACGAATCGGGGCGTTGAAGGAAAG
JMFF013K11+ GGACATACTTCCCGCCGAACTTGCCGAACCGGCCGAACGAATCGGGGCGTTGAAGGAAAG
JMFF004E06+ GGACATACTTCCCGCCGAACTTGCCGAACCGGCCGAACGAATCGGGGCGTTGAAGGAAAG
                      ____________________________________________________________
consensus GGACATACTTCCCGCCGAACTTGCCGAACCGGCCGAACGAATCGGGGCGTTGAAGGAAAG
 
. : . : . : . : . : . :
JMSF032L09+ TCAGTTCAGACGCCTCCCGAGCCTCCATTTGCTGCTTTAGAGATCCTGCGGTGAGAGTGC
JMFF050H12+ TCAGTTCAGACGCCTCCCGAGCCTCCATTTGCTGCTTTAGAGATCCTGCGGTGAGAGTGC
JMFF013K11+ TCAGTTCAGACGCCTCCCGAGCCTCCATTTGCTGCTTTAGAGATCCTGCGGTGAGAGTGC
JMFF004E06+ TCAGTTCAGACGCCTCCCGAGCCTCCATTTGCTGCTTTAGAGATCCTGCGGCGAGAGTGC
                      ____________________________________________________________
consensus TCAGTTCAGACGCCTCCCGAGCCTCCATTTGCTGCTTTAGAGATCCTGCGGTGAGAGTGC
 
. : . : . : . : . : . :
JMSF032L09+ AGAAAACCGCAGGTGCCTTGGCTGGGCGCGTCGTGAATTTGTTCAGTTTCAGAGGTAGGT
JMFF050H12+ AGAAAACCGCAGGTTCCTTGGCTGGGCGCGTCGTGAATTTGTTCAGTTTCAGAGGTAGGT
JMFF013K11+ AGAAAACCGCAGGTGCCTTGGCTGGGCGCGTCGTGAATTTGTTCAGTTTCAGAGGTAGGT
JMFF004E06+ AGAAAACCGCAGGTGCCTTGGCTGGGCGCGTCGTGAATTTGTTCAGTTTCAGAGGTAGGT
                      ____________________________________________________________
consensus AGAAAACCGCAGGTGCCTTGGCTGGGCGCGTCGTGAATTTGTTCAGTTTCAGAGGTAGGT
 
. : . : . : . : . : . :
JMSF032L09+ GGCGCAAGGAGGAGGAGGAGGCGGAGGCGGCGGCACCGGTCGGCTTTGGGAGCAATGGGG
JMFF050H12+ GGCGCAAGGAGGAGGAGGAGGCGGAGGCGGCGGCACCGGTCGGCTTTGGGAGCAATGGGG
JMFF013K11+ GGCGCAAGGAGGAGGAGGAGGCGGAGGCGGCGGCACCGGTCGGCTTTGGGAGCAATGGGG
JMFF004E06+ GGCGCAAGGAGGAGGAGGAGGCGGAGGCGGCGGCACCGGTCGGCTTTGGGAGCAATGGGG
                      ____________________________________________________________
consensus GGCGCAAGGAGGAGGAGGAGGCGGAGGCGGCGGCACCGGTCGGCTTTGGGAGCAATGGGG
 
. : . : . : . : . : . :
JMSF032L09+ CTGACGTTTTCGTGGTGGCGGCAGAGAAGGCCATGTTTGGAATGCGAGCTAAAGTAT
JMFF050H12+ CTGACGTTTTCGTGGTGGCGGCAGAGAAGGCCATGTTTGGAATGCGAGCTAAAGTAT
JMFF013K11+ CTGACGTTTTCGTGGTGGCGGCAGAGAAGGCCATGTTTGGAATGCGAGCTAAAGTAT
JMFF004E06+ CTGACGTTTTCGTGGTGGCGGCAGAGAAGGCCATGTTTGGAATGCGAGCTAAAGTATACT
                      ____________________________________________________________
consensus CTGACGTTTTCGTGGTGGCGGCAGAGAAGGCCATGTTTGGAATGCGAGCTAAAGTATACT