Previous Contig 000180:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D09Sequence558000180 (6)gb:AX298155_14653362e-33Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-738011065 (4)gb:AX298155_14653361e-33Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF011A15Sequence560000180 (6)gb:AX298155_14653366e-34Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-739011065 (4)gb:AX298155_14653363e-33Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF032E21Sequence586000180 (6)gb:AX298155_14653362e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-715011065 (4)gb:AX298155_14653363e-29Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF050F07Sequence640000180 (6)gb:AX298155_14653361e-37Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-586021896gb:AX298155_14653361e-21Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF051D24Sequence528000180 (6)gb:AX298155_14653366e-27Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-411011065 (4)gb:AF061282_17651970.024Sorghum bicolor 22 kDa kafirin cluster.
JMSF044E03Sequence713000180 (6)gb:AX298155_14653365e-64Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-752000344 (42)gb:AX298155_14653365e-40Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044E03+ CTGGATGCGGAGATAGTTATCTCCGGCTTTAAGAGAACGGAAAATGGTGGCGAT
                      ____________________________________________________________
consensus CTGGATGCGGAGATAGTTATCTCCGGCTTTAAGAGAACGGAAAATGGTGGCGAT
 
. : . : . : . : . : . :
JMSF044E03+ ATGATAATCCACCATGTCCGCACTTGCACCGGAGAATACATCAATCAAAGGGTTGCCGTC
                      ____________________________________________________________
consensus ATGATAATCCACCATGTCCGCACTTGCACCGGAGAATACATCAATCAAAGGGTTGCCGTC
 
. : . : . : . : . : . :
JMSF044E03+ TCGTTGGGCCAGCCACCCCAAAACACCCCATGTCGCCGCCTGTTGCGCCGTGTACTTATC
                      ____________________________________________________________
consensus TCGTTGGGCCAGCCACCCCAAAACACCCCATGTCGCCGCCTGTTGCGCCGTGTACTTATC
 
. : . : . : . : . : . :
JMSF044E03+ GGCTTTTTTTGCATTGCCGGTGCCGATCGACAATATCAATAAATGGTGGCACCCAGTTGG
                      ____________________________________________________________
consensus GGCTTTTTTTGCATTGCCGGTGCCGATCGACAATATCAATAAATGGTGGCACCCAGTTGG
 
. : . : . : . : . : . :
JMSF044E03+ ATCATTCGACGAAATTGATGATGGCAGGAATTTTTTATCCTCAGCCATCATCCTTTGTGT
                      ____________________________________________________________
consensus ATCATTCGACGAAATTGATGATGGCAGGAATTTTTTATCCTCAGCCATCATCCTTTGTGT
 
. : . : . : . : . : . :
JMSF044E03+ CACCGTGCTAACCGCAATAAGAGTCGGATTGTTTGCCGCTACACCTCCGTCAATGAGGTT
                      ____________________________________________________________
consensus CACCGTGCTAACCGCAATAAGAGTCGGATTGTTTGCCGCTACACCTCCGTCAATGAGGTT
 
. : . : . : . : . : . :
JMSF044E03+ ATACTCGACCTTTCCGCCCTTAGCATCGGCGGTGTCAAAGTAATGGCCGGGGAGGTACGT
                      ____________________________________________________________
consensus ATACTCGACCTTTCCGCCCTTAGCATCGGCGGTGTCAAAGTAATGGCCGGGGAGGTACGT
 
. : . : . : . : . : . :
JMSF044E03+ GGGAGCTGCGGAGGTGGCAATGCATATGTCTGACAACTTAGCATTCTTTTCGGGGGAATC
JMFF011A15+ TTTATATCAAAGGTAGGG
JMFF004D09+ TTTATATCAAAGGTAGGG
                      ____________________________________________________________
consensus GGGAGCTGCGGAGGTGGCAATGCATATGTCTGACAACTTAGCTTTATATCAAAGGTAGGG
 
. : . : . : . : . : . :
JMSF044E03+ AT--TAACATGAGTCAAAGTTTGGCTCAACCGGGTGTCTCCCAGGTTGTTCTTGAGGACT
JMFF011A15+ ATGATAACGTCAGTCAAAGTTTGGCTTAACCGGGTGTCTCCCAGTTTGTCCTGGAGGACT
JMFF051D24+ TCAGTCAAAGTTTGGC-TAACCGGGTGTCTCCCAGTTGTTCCTGGAGGACT
JMFF004D09+ ATGATAACGTCAGTCAAAGTTTGGCTTAACCGGGTGTCTCCCAGTTTGTCCTGGAGGACT
                      ____________________________________________________________
consensus ATGATAACGTCAGTCAAAGTTTGGCTTAACCGGGTGTCTCCCAGTTTGTCCTGGAGGACT
 
. : . : . : . : . : . :
JMSF044E03+ TGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTGCCAACATGTTTTGCCACGCCGATGTG
JMFF011A15+ TGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTATCAACAGGTTCTGCATCTCCGATGTG
JMFF051D24+ TGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTATCAACAGGTTCTGCATCTCCGATGTG
JMFF004D09+ TGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTATCAACAGGTTCTGCATCTCCGATGTG
                      ____________________________________________________________
consensus TGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTATCAACAGGTTCTGCATCTCCGATGTG
 
. : . : . : . : . : . :
JMSF044E03+ TTTCCTGGAAAGATATATGGTCCGTGCTCCTTGTAGAAAGGGACGATATCCTTGCCGGCG
JMFF011A15+ TTTGCTGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
JMFF051D24+ TTTGCTGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
JMFF050F07+ TGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
JMFF032E21+ GCTGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
JMFF004D09+ TTTGCTGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
                      ____________________________________________________________
consensus TTTGCTGGGAAGATCTTTGGTCCGTGCTCCTTGTAGAAAGTGACGATATCCTCGCCGGCA
 
. : . : . : . : . : . :
JMSF044E03+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGCTAACATGGTGGTCATCAGTCCTCCGGTG
JMFF011A15+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
JMFF051D24+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
JMFF050F07+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
JMFF032E21+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
JMFF004D09+ TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
                      ____________________________________________________________
consensus TAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGTTAACATGGTGGTCATCAGCCCTCCGGTG
 
. : . : . : . : . : . :
JMSF044E03+ C
JMFF011A15+ CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
JMFF051D24+ CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
JMFF050F07+ CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
JMFF032E21+ CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
JMFF004D09+ CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
                      ____________________________________________________________
consensus CTGGTTCCGGCAATCACATCGAAGTAGTCCGCTACTCTTGCATCCGGACCGTCCAAAGCT
 
. : . : . : . : . : . :
JMFF011A15+ TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
JMFF051D24+ TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
JMFF050F07+ TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
JMFF032E21+ TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
JMFF004D09+ TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
                      ____________________________________________________________
consensus TGAAGCTGCTTTTCAAGGTAAGCAACAATGGTGCCGGGGATGATGCCGCGGATGCCACCT
 
. : . : . : . : . : . :
JMFF011A15+ CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
JMFF051D24+ CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
JMFF050F07+ CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
JMFF032E21+ CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
JMFF004D09+ CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
                      ____________________________________________________________
consensus CCATCAATGCTAAGGATGGTGACAACGCCGCCGGGAGGGATGGACGGAGCATTGTACTCT
 
. : . : . : . : . : . :
JMFF011A15+ CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
JMFF051D24+ CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
JMFF050F07+ CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
JMFF032E21+ CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
JMFF004D09+ CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
                      ____________________________________________________________
consensus CCGGTGGCGGGATCGGACGGGGCTGTCTGGCTGTTTCCCATTTCAAAGGATTGGTGTGAT
 
. : . : . : . : . : . :
JMFF011A15+ ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTTTAA
JMFF051D24+ ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTTTAA
JMFF050F07+ ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTTTAA
JMFF032E21+ ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTT
JMFF004D09+ ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTTTAATGT
                      ____________________________________________________________
consensus ATATAAAATAAATGTTATCAAGAGAAAATGATAAAAGATTTTTGTTGGTTTCTTTAATGT