Previous Contig 000173:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001C06Sequence544000173 (8)gb:AY063846_15657942e-53Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds785008572 (8)gb:AY063846_15657949e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFF004B02Sequence532000173 (8)gb:AY063846_15657942e-40Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds777008572 (8)gb:AY063846_15657949e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFF004F20Sequence582000173 (8)gb:AY063846_15657949e-49Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds769008572 (8)gb:AY063846_15657949e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFF008L15Sequence612000173 (8)gb:AY063846_15657942e-51Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds723008572 (8)gb:AY063846_15657948e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFF020B09Sequence594000173 (8)gb:AY063846_15657942e-50Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds771008572 (8)gb:AY063846_15657940.004Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFF022K12Sequence459000173 (8)gb:AY063846_15657944e-27Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds724008572 (8)gb:AY063846_15657948e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMFN042H15Sequence610000173 (8)gb:AY063846_15657948e-69Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds
JMSF047P14Sequence683000173 (8)gb:AY063846_15657942e-73Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds726008572 (8)gb:AY063846_15657948e-04Arabidopsis thaliana putative RNA-binding protein (At3g15010) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN042H15+ CGAATAGA
JMSF047P14+ CGAATAGA
                      ____________________________________________________________
consensus CGAATAGA
 
. : . : . : . : . : . :
JMFN042H15+ GCATACCCTTTAGACTANCCGGTCACCTTATCAAATCCTAGTGGCCCTTCCTCTATCTCC
JMSF047P14+ GCATACCCTTTAGACTTACCGGTCACCTTATCAAATCCTAGTGGCCCTTCCTCTATCTCC
                      ____________________________________________________________
consensus GCATACCCTTTAGACTTACCGGTCACCTTATCAAATCCTAGTGGCCCTTCCTCTATCTCC
 
. : . : . : . : . : . :
JMFN042H15+ CCATACATTGAGAACTGCTGCAACAATCTCTCCGTGGGCATATCATAAGGCACATTCCCC
JMFF001C06+ CCCC
JMSF047P14+ CCATACATTGAGAACTGCTGCAACAATCTCTCCGTGGGCATATCATAAGGCACATTCCCC
                      ____________________________________________________________
consensus CCATACATTGAGAACTGCTGCAACAATCTCTCCGTGGGCATATCATAAGGCACATTCCCC
 
. : . : . : . : . : . :
JMFN042H15+ ACATATATCTTCCTCAATGATATATCCACAGGATTATTCGAGCTCCCACCTCCAGGCCCA
JMFF001C06+ ACATATATCTTCCTCAATGATATATCCACAGGATTATTCGAGCTCCCACCTCCAGGCCCA
JMSF047P14+ ACATATATCTTCCTCAATGATATATCCACAGGATTATTCGAGCTCCCACCTCCAGGCCCA
JMFF008L15+ CCCA
                      ____________________________________________________________
consensus ACATATATCTTCCTCAATGATATATCCACAGGATTATTCGAGCTCCCACCTCCAGGCCCA
 
. : . : . : . : . : . :
JMFN042H15+ CCCTGCATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
JMFF001C06+ CCCTGCATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
JMSF047P14+ CCCTGCATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
JMFF020B09+ ATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
JMFF008L15+ CCCTGCATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
JMFF004F20+ GCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
                      ____________________________________________________________
consensus CCCTGCATACCGGCAGCTGCCAGCTGTGTGACAGTCATTCGACCATCAATTTGCTTACTG
 
. : . : . : . : . : . :
JMFN042H15+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMFF001C06+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMSF047P14+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMFF020B09+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMFF008L15+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMFF004F20+ GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
JMFF004B02+ TAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
                      ____________________________________________________________
consensus GGTTCCTTTAGAGCAAGCAGGGCTCCATCAATATGTTTAAAGGTGATAAAGCCGTAACCT
 
. : . : . : . : . : . :
JMFN042H15+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF001C06+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMSF047P14+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF020B09+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF008L15+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF004F20+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF022K12+ TCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
JMFF004B02+ TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
                      ____________________________________________________________
consensus TTACTCTTTCCAGTAGCCTTATCGAGGATTACCACGGCCTCCTCAAGCTCGCCGTAGGTG
 
. : . : . : . : . : . :
JMFN042H15+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF001C06+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMSF047P14+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF020B09+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF008L15+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF004F20+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF022K12+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
JMFF004B02+ GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
                      ____________________________________________________________
consensus GAGAAAAGGGAACGAAGCTTATCGGTGGTAGTTTCCCAACCGAGGCCGCGAATGAAAAGC
 
. : . : . : . : . : . :
JMFN042H15+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF001C06+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMSF047P14+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF020B09+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF008L15+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF004F20+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF022K12+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
JMFF004B02+ TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
                      ____________________________________________________________
consensus TTCCGCTGCGTCGTGTCTTGGTCGGCAATTGAACGGACGGCGCCGAGGACGTCAGGGTGA
 
. : . : . : . : . : . :
JMFN042H15+ CGAACAACTGTGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF001C06+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMSF047P14+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF020B09+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF008L15+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF004F20+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF022K12+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
JMFF004B02+ CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
                      ____________________________________________________________
consensus CGAACAACTGCGTTCTGGACGATCTCGAAGAGCTGGTCGCGCGTGAAGGATTCGAGGATT
 
. : . : . : . : . : . :
JMFN042H15+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF001C06+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMSF047P14+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF020B09+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF008L15+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF004F20+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF022K12+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
JMFF004B02+ TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
                      ____________________________________________________________
consensus TTGCGCGCGTCTTCGAGCGACAGCCTGGGGAGAAAGGAGGGGTCAGAAACAACGCCGTTG
 
. : . : . : . : . : . :
JMFN042H15+ TC
JMFF001C06+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMSF047P14+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMFF020B09+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMFF008L15+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMFF004F20+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMFF022K12+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
JMFF004B02+ TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
                      ____________________________________________________________
consensus TCTTCGAGCTTCCGTTTTTTCATGAAGTCCATTGCTGAGAATTGAGGAACGAGGATCTTC
 
. : . : . : . : . : . :
JMSF047P14+ AGAGAAGCTTAA
JMFF020B09+ AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
JMFF008L15+ AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
JMFF004F20+ AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
JMFF022K12+ AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
JMFF004B02+ AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
                      ____________________________________________________________
consensus AGAGAAGCTTAATCAAGTAATATCCTTAAATAGCTTGAATTTAAAACCCTAACCCTAACA
 
. : . : . : . : . : . :
JMFF020B09+ AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT
JMFF008L15+ AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT
JMFF004F20+ AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT
JMFF022K12+ AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT
JMFF004B02+ AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT
                      ____________________________________________________________
consensus AAGAAAGGGTTTGATACTTCGCAAAGGTGACGATTGGGGTTGGCGGATTGCCCAGAGACT