Previous Contig 000169:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003P18Sequence536000169 (6)gb:AK118951_18169002e-21Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA
JMSF013L20Sequence466000169 (6)gb:OSJN00262_16975925e-29Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073E02, complete seque697009552 (8)gb:AK118951_18169009e-42Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA
JMSF015A16Sequence358000169 (6)772009552 (8)gb:AK118951_18169007e-49Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA
JMSF034M01Sequence699000169 (6)gb:AK118951_18169007e-71Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA500009552 (8)gb:AK118951_18169002e-24Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA
JMSF040G09Sequence649000169 (6)gb:AK118951_18169006e-71Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA883009552 (8)gb:AK118951_18169007e-53Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA
JMSF052A06Sequence681000169 (6)gb:OSJN00262_16975927e-47Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073E02, complete seque882009552 (8)gb:AK118951_18169004e-49Arabidopsis thaliana At5g18485 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040G09+ GTGTAAGAATGCAAAGTGTTAACCTTGCTCATCATATCGTTAAAAA
JMSF034M01+ GTGTAAGAATGCAAAGTGTTTACCTTGCTCATCATATCGTTAAAAA
                      ____________________________________________________________
consensus GTGTAAGAATGCAAAGTGTTTACCTTGCTCATCATATCGTTAAAAA
 
. : . : . : . : . : . :
JMSF040G09+ CTTCCTTGGATGGCTCAACAACCATGACTCCAGAATTCAGCCTTTCTGAATGTTTCAAGT
JMSF034M01+ CTTCCTTGGATGGCTCAACAACCATGACTCCAGAATTCAGCCTTTCTGAATGTTTCAAGT
                      ____________________________________________________________
consensus CTTCCTTGGATGGCTCAACAACCATGACTCCAGAATTCAGCCTTTCTGAATGTTTCAAGT
 
. : . : . : . : . : . :
JMSF040G09+ TTGCACAAAACTTTCCACATTTAAATAGGTCTTCTATGTTCTTAACAACTATCGTATCAG
JMSF034M01+ TTGCACAAAACTTTCCACATTTAAATAGGTCTTCTATGTTCTTAACAACTATCGTATCAG
JMSF052A06+ TTCTTAACAACTATCGTATCAG
                      ____________________________________________________________
consensus TTGCACAAAACTTTCCACATTTAAATAGGTCTTCTATGTTCTTAACAACTATCGTATCAG
 
. : . : . : . : . : . :
JMSF040G09+ CATCAAGATACACCACTTTCTTGTATCTAGTCATATTGAAGATTTTTAGCTTTGTATAGA
JMSF034M01+ CATCAAGATACACCACTTTCTTGTATCTAGTCATATTGAAGATTTTTAGCTTTGTATAGA
JMSF052A06+ CATCAAGATACACCACTTTCTTGTATCTAGTCATATTGAAGATTTTTAGCTTTGTATAGA
                      ____________________________________________________________
consensus CATCAAGATACACCACTTTCTTGTATCTAGTCATATTGAAGATTTTTAGCTTTGTATAGA
 
. : . : . : . : . : . :
JMSF040G09+ CACCCCAGAACCTCTTCGGCCTCACTTGATTTGGGTTCGCCAACAAAGTAATTTCTTCCA
JMSF034M01+ CACCCCAGAACCTCTTCGGCCTCACTTGATTTGGGTTCGCCAACAAAGTAATTTCTTCCA
JMSF013L20+ TCGGCCTCACTTGATTTGGGTTCGCCAACAAAGTAATTTCTTCCA
JMSF052A06+ CACCCCAGAACCTCTTCGGCCTCACTTGATTTGGGTTCGCCAACAAAGTAATTTCTTCCA
                      ____________________________________________________________
consensus CACCCCAGAACCTCTTCGGCCTCACTTGATTTGGGTTCGCCAACAAAGTAATTTCTTCCA
 
. : . : . : . : . : . :
JMSF040G09+ CAATCCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
JMSF034M01+ CAATCCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
JMSF013L20+ CAATCCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
JMSF052A06+ CAATCCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
JMFF003P18+ CCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
                      ____________________________________________________________
consensus CAATCCACCCATCAGCCTGAAGGAGCTGTTTGGCATAGCTGGAGACACCATCTGAGACCA
 
. : . : . : . : . : . :
JMSF040G09+ AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
JMSF034M01+ AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
JMSF013L20+ AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
JMSF052A06+ AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
JMFF003P18+ AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
                      ____________________________________________________________
consensus AAACAACCATATCTTTAGTGGTTCCAGTATCCCGGATAGACTTGCCGAGAACTCGAACGC
 
. : . : . : . : . : . :
JMSF040G09+ CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
JMSF034M01+ CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
JMSF013L20+ CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
JMSF052A06+ CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
JMSF015A16+ GCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
JMFF003P18+ CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
                      ____________________________________________________________
consensus CGAGGAGGAACTCATCGCCGTAGAGAAGCGTGACGTAAGCTTCTTCCGAAGATTGCGATC
 
. : . : . : . : . : . :
JMSF040G09+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
JMSF034M01+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
JMSF013L20+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
JMSF052A06+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
JMSF015A16+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
JMFF003P18+ TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
                      ____________________________________________________________
consensus TCGGTTCTCCAGCAACGCAATAATTGTTAAGTACACACAAAATTAGGCACAGCCAAACAA
 
. : . : . : . : . : . :
JMSF040G09+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
JMSF034M01+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
JMSF013L20+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
JMSF052A06+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
JMSF015A16+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
JMFF003P18+ CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
                      ____________________________________________________________
consensus CCCCAAATCTCCCACTGAAAGATCCCATGGTTTTCTGGAGAAAATTATGGGATTTGGCCG
 
. : . : . : . : . : . :
JMSF040G09+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
JMSF034M01+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
JMSF013L20+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
JMSF052A06+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
JMSF015A16+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
JMFF003P18+ TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
                      ____________________________________________________________
consensus TAGGAAGGCGAAGAAATTGAAGATCTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACAT
 
. : . : . : . : . : . :
JMSF040G09+ CT
JMSF034M01+ CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAG
JMSF013L20+ CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAGTCTGTAATC
JMSF052A06+ CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAGTCTGTAATC
JMSF015A16+ CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAGTCTGTAATC
JMFF003P18+ CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAGTCTGTAATC
                      ____________________________________________________________
consensus CTAAAGACTGAAACTTTTTTAAGGGGCTTTGAACTGTATGAATTTTTAAAGTCTGTAATC
 
. : . : . : . : . : . :
JMSF052A06+ ATGAGAAAGAAACAATTTTAAATGAAAAGAATATTTATAAATTACGTTTCTCCGTTGAAA
JMSF015A16+ ATGAGAAAGAAACAATTTTAAATGAAAAGAATATTTATAAATTACGTTTCTCCGTTGAAA
JMFF003P18+ ATGAGAAAGAAACAATTTTAAATGAAAAGAATATTTATAAATTACGTTTCTCCGTTGAAA
                      ____________________________________________________________
consensus ATGAGAAAGAAACAATTTTAAATGAAAAGAATATTTATAAATTACGTTTCTCCGTTGAAA
 
. : . : . : . : . : . :
JMSF052A06+ TTTCGCCTGGTCTTCATTGCCGTCTTGCGGTCTTGGCCTTCTTGGCGTGCTGGAATC
JMSF015A16+ TTTCGCCTGGTCT
JMFF003P18+ TTTCGCCTGGTCTTCATTGCCGTCTTGCGGTCTTGGCCTTCTTGGCGTGCTGGAATCTGC
                      ____________________________________________________________
consensus TTTCGCCTGGTCTTCATTGCCGTCTTGCGGTCTTGGCCTTCTTGGCGTGCTGGAATCTGC