Previous Contig 000162:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003O06Sequence518000162 (8)
JMFF016I21Sequence644000162 (8)gb:AY505498_16098452e-34Zea mays glossy1 protein gene, complete cds.726001272 (7)gb:AP003565_18308989e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFF020H15Sequence428000162 (8)707001272 (7)gb:AP003565_18308982e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFS109G07Sequence619000162 (8)
JMFS150F12Sequence614000162 (8)gb:AY505498_16098455e-32Zea mays glossy1 protein gene, complete cds.
JMSF033E11Sequence646000162 (8)gb:AB099512_15261447e-37Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_749001272 (7)gb:AP003565_18308988e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF043K04Sequence805000162 (8)gb:AB099512_15261443e-32Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_777001272 (7)gb:AP003565_18308981e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF050P09Sequence704000162 (8)gb:AB099512_15261445e-75Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_706001272 (7)gb:AP003565_18308982e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050P09+ TTCCCGAGCAT
                      ____________________________________________________________
consensus TTCCCGAGCAT
 
. : . : . : . : . : . :
JMSF050P09+ ATCATAGAGAGGCATAAAGAGGCAAAAATTAGTCCTTTTATCCATATGGTGTAGACCGTA
                      ____________________________________________________________
consensus ATCATAGAGAGGCATAAAGAGGCAAAAATTAGTCCTTTTATCCATATGGTGTAGACCGTA
 
. : . : . : . : . : . :
JMSF050P09+ GTACGTTGGGCTATAAATAAGGTACTTGAGAACTGGAATAGTCTTGAAGAGGTGACTAGG
                      ____________________________________________________________
consensus GTACGTTGGGCTATAAATAAGGTACTTGAGAACTGGAATAGTCTTGAAGAGGTGACTAGG
 
. : . : . : . : . : . :
JMSF050P09+ CATGATTTCAACATTGCTATACCCCAAACATCTAAGAAAATCAAATGCCAAAATATAACT
                      ____________________________________________________________
consensus CATGATTTCAACATTGCTATACCCCAAACATCTAAGAAAATCAAATGCCAAAATATAACT
 
. : . : . : . : . : . :
JMSF050P09+ GTAGATAACGATTATCGAACCATGTCCAAGAAACGCGGTTCCCAGCGTTGGAATTCCTAC
                      ____________________________________________________________
consensus GTAGATAACGATTATCGAACCATGTCCAAGAAACGCGGTTCCCAGCGTTGGAATTCCTAC
 
. : . : . : . : . : . :
JMSF050P09+ AATTACACACAGTAACAGATGTTCCAGAAATGCTGCACTGCCCGCTGTAAATGGATGCGG
                      ____________________________________________________________
consensus AATTACACACAGTAACAGATGTTCCAGAAATGCTGCACTGCCCGCTGTAAATGGATGCGG
 
. : . : . : . : . : . :
JMSF050P09+ AACTTTAGAATCATGGTGTAGCCAATGATAAAGTGGATACAGATCGGAGCTATGCAATAA
                      ____________________________________________________________
consensus AACTTTAGAATCATGGTGTAGCCAATGATAAAGTGGATACAGATCGGAGCTATGCAATAA
 
. : . : . : . : . : . :
JMSF050P09+ TCTATGCATCAAATAGTAAAGCGGCTCTGAGAATCCCATATGCAAAACGAGACAGTAAAC
JMSF033E11+ GAATCCCATATGCAAAACGAGACAGTAAAC
                      ____________________________________________________________
consensus TCTATGCATCAAATAGTAAAGCGGCTCTGAGAATCCCATATGCAAAACGAGACAGTAAAC
 
. : . : . : . : . : . :
JMSF050P09+ AACCCCTTTAAATTCCCAGGTGGGGAGATTAGCCAAGGAA-GGGAAGCTCATATAGGCAA
JMSF033E11+ AACCCCTTTAAATTCCCAGGTGGGGAGATTAGCCAAGGAA-GGGAAGCTCATATAGGCAA
JMFS150F12+ GGGAGATTAGCCAAGGAA-GGGAAGCTCATATAGGCAA
JMFF016I21+ TGGGGAGATTAGCCAAGGAA-GGGAAGCTCATATAGGCAA
JMSF043K04+ TGGGGAGATTAGCCAAGGAAGGGGAAGCTCATATAGGCAA
                      ____________________________________________________________
consensus AACCCCTTTAAATTCCCAGGTGGGGAGATTAGCCAAGGAA-GGGAAGCTCATATAGGCAA
 
. : . : . : . : . : . :
JMSF050P09+ ATGAAGCCAAAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
JMSF033E11+ ATGAAGCCAAAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
JMFS150F12+ ATGAAGCCANAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
JMFF016I21+ ATGAAGCCAAAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
JMSF043K04+ ATGAAGCCAAAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
                      ____________________________________________________________
consensus ATGAAGCCAAAATCGCTTGAAGTATTAGGAAATTGTCCCAATGCCATTCCTTGTCGATTT
 
. : . : . : . : . : . :
JMSF050P09+ GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
JMSF033E11+ GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
JMFS150F12+ GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
JMFF016I21+ GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
JMSF043K04+ GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
                      ____________________________________________________________
consensus GTTCAAAATCTATGCCTTGTTGAGACACCCTTTTTGCCCGGTTAAAGAATAGCATATTAC
 
. : . : . : . : . : . :
JMSF050P09+ TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
JMSF033E11+ TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
JMFS150F12+ TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
JMFF016I21+ TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
JMSF043K04+ TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
                      ____________________________________________________________
consensus TGTAAGAACTCCACAACTGATGAACAAGGCCTCTCAGCCCAGTAAGAACAAGAATATGTA
 
. : . : . : . : . : . :
JMSF050P09+ AGCACCAAATATCCTCCCAGCTCTCTTTCCAAAC
JMSF033E11+ AGCACCAAATATCCTCCCAGCTCTCTTTCCAAACCAGAGAATATATGAATTTTGCAATCA
JMFS150F12+ AGCACCAAATATCCTCCCAGCTCTCTTTCCAAACCAGAGAATATATGAATTTTGCAATCA
JMFF016I21+ AGCACCAAATATCTTCCCAGCTCTCTTTCCAAACCAGAGAATATATGAATTTTGCAATCA
JMSF043K04+ AGCACCAAATATCCTCCCAGCTCTCTTTCCAAACCAGAGAATATATGAATTTTGCAATCA
                      ____________________________________________________________
consensus AGCACCAAATATCCTCCCAGCTCTCTTTCCAAACCAGAGAATATATGAATTTTGCAATCA
 
. : . : . : . : . : . :
JMSF033E11+ ATGGTCCACATAACAAATACTTGAAATTTCCCAGGTTCTCCCATGGCCAAGCAAACAAGG
JMFS150F12+ ATGGTCCACATAACAAATACTTGAAATTTCCCAGGTTCTCCCATGGCCAAGCAAACAAGG
JMFF016I21+ ATGGTCCACATAACAAATACTTGAAATTTCCCAGGTTCTCCCATGGCCAAGCAAACAAGG
JMSF043K04+ ATGGTCCACATAACAAATACTTGAAATTTCCCAGGTTCTCCCATGGCCAAGCAAACAAGG
                      ____________________________________________________________
consensus ATGGTCCACATAACAAATACTTGAAATTTCCCAGGTTCTCCCATGGCCAAGCAAACAAGG
 
. : . : . : . : . : . :
JMSF033E11+ CTGCATCTTTCTTCCTCATAAGAGTATTTCCTTCCTCCTCTTTGTGAACAGCACCATTTT
JMFS150F12+ CTGCATCTTTCTTCCTCATAAGAGTATTTCCTTCCTCCTCTTTGTGAACAGCACCATTTT
JMFF016I21+ CTGCATCTTTCTTCCTCATAAGAGTATTTCCTTCCTCCTCTTTGTGAACAGCACCATTTT
JMSF043K04+ CTGCATCTTTCTTCCTCATAAGAGTATTTCCTTCCTCCTCTTTGTGAACAGCACCATTTT
                      ____________________________________________________________
consensus CTGCATCTTTCTTCCTCATAAGAGTATTTCCTTCCTCCTCTTTGTGAACAGCACCATTTT
 
. : . : . : . : . : . :
JMSF033E11+ CTTTCCCCATTTCACTGGAAAACCTGTGTGTTCTTGAAATCCAATACAGATTGATGACCT
JMFS150F12+ CTTTCCCCATTTCACTGGAAAACCTGTGTGTTCTTGAAATCCAATACAGATTGATGACCT
JMFF016I21+ CTTTCCCCATTTCACTGGAAAACCTGTGTGTTCTTGAAATCCAATACAGATTGATGACCT
JMSF043K04+ CTTTCCCCATTTCACTGGAAAACCTGTGTGTTCTTGAAATCCAATACAGATTGATGACCT
                      ____________________________________________________________
consensus CTTTCCCCATTTCACTGGAAAACCTGTGTGTTCTTGAAATCCAATACAGATTGATGACCT
 
. : . : . : . : . : . :
JMSF033E11+ CACCAAACAGGCAAAAAGGAGAAAAAGGGTATAAATAGTAAAGAATTCAAACAAGATTGG
JMFS150F12+ CACCAAACAGGCAAAAAGGAGAAAAAGGGTATAAATAGTAAAGAATTCAAACAAGATTGG
JMFF016I21+ CACCAAACAGGCAAAAAGGAGAAAAAGGGTATAAATAGTAAAGAATTCAAACAAGATTGG
JMSF043K04+ CACCAAACAGGCAAAAAGGAGAAAAAGGGTATAAATAGTAAAGAATTCAAACAAGATTGG
JMFS109G07+ AAGATTGG
                      ____________________________________________________________
consensus CACCAAACAGGCAAAAAGGAGAAAAAGGGTATAAATAGTAAAGAATTCAAACAAGATTGG
 
. : . : . : . : . : . :
JMSF033E11+ AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
JMFS150F12+ AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
JMFF016I21+ AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
JMSF043K04+ AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
JMFS109G07+ AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
                      ____________________________________________________________
consensus AGAGGGGATATAAAGGAAAGCAATTGAAGTTGAAAACAGACAAAACAAAAGAAGGTTTCC
 
. : . : . : . : . : . :
JMSF033E11+ CCTTGTTGTTGGATCT
JMFS150F12+ CCTTGTTGTTGGATCTGTACAACCCAGTTTTCCTATC
JMFF016I21+ CCTTGTTGTTGGATCTGTACAACCCAGTTTTCCTATCTACCCTCTTTATGGTTCT
JMSF043K04+ CCTTGTTGTTGGATCTGTACAACCCAGTTTTCCTATCTACCCTCTTTATGTTTCTTCTAG
JMFS109G07+ CCTTGTTGTTGGATCTGTACAACCCAGTTTTCCTATCTACCCTCTTTATGTTTCTTCTAG
                      ____________________________________________________________
consensus CCTTGTTGTTGGATCTGTACAACCCAGTTTTCCTATCTACCCTCTTTATGTTTCTTCTAG
 
. : . : . : . : . : . :
JMSF043K04+ GCTTGTAGATAGCCAGAGTATTATACAAGTAGCCCCCAAAGACAGAAACTTACAAGGCTG
JMFS109G07+ GCTTGTAGATAGCCAGAGTATTATACAAGTAGCCCCCAAAGACAGAAACTTACAAGGCTG
JMFF003O06+ ATACAAGTAGCCCCCAAAGACAGAAACTTACAAGGCTG
                      ____________________________________________________________
consensus GCTTGTAGATAGCCAGAGTATTATACAAGTAGCCCCCAAAGACAGAAACTTACAAGGCTG
 
. : . : . : . : . : . :
JMSF043K04+ GGTTTACAGTTGGATTTCCCAATCATAAATTCATTAAGATTAACATCTCTTCTCCTTTCT
JMFS109G07+ GGTTTACAGTTGGATTTCCCAATCATAAATTCATTAAGATTAACATCTCTTCTCCTTTCT
JMFF020H15+ TCCTTTCT
JMFF003O06+ GGTTTACAGTTGGATTTCCCAATCATAAATTCATTAAGATTAACATCTCTTCTCCTTTCT
                      ____________________________________________________________
consensus GGTTTACAGTTGGATTTCCCAATCATAAATTCATTAAGATTAACATCTCTTCTCCTTTCT
 
. : . : . : . : . : . :
JMSF043K04+ TTTGGCATAGAACAAATTTCCCACCTATTCAAATTGACAGGC
JMFS109G07+ TTTGGCATAGAACAAATTTCCCACCTATTCAAATTGACAGGCACCCAATTATCATAACCA
JMFF020H15+ TTTGGCATAGAACAAATTTCCCACCTATTCAAATTGACAGGCNCCCAATTATCATAACCA
JMFF003O06+ TTTGGCATAGAACAAATTTCCCNCCTATTCAAATTGACAGGCNCCCAATTATCATAACCA
                      ____________________________________________________________
consensus TTTGGCATAGAACAAATTTCCCACCTATTCAAATTGACAGGCACCCAATTATCATAACCA
 
. : . : . : . : . : . :
JMFS109G07+ AAATTGGGTCATTGATATATCTCCACGTTTTGCCCAAGCTGACAGCTATACGGTCTATAA
JMFF020H15+ AAATTGGGTCATTGATATATCTCCACGTTTTGCCCAAGCTGACAGCTATACGGTNTATAA
JMFF003O06+ AAATTGGGTCATTGATATATCTCCACGTTTTGCCCAAGCTGACAGCTATACGGTNTATAA
                      ____________________________________________________________
consensus AAATTGGGTCATTGATATATCTCCACGTTTTGCCCAAGCTGACAGCTATACGGTCTATAA
 
. : . : . : . : . : . :
JMFS109G07+ CCTAAGAAATTAATGCGATATGGTAGTTTTGGAGAAATTATAAATGGTTATCTGGCTGGC
JMFF020H15+ CCTAAGAAATTAATGCGATATGGTAGTTTTGGAGAAATTATAAATGGTTATCTGGCTGGC
JMFF003O06+ CCTAAGAAATTAATGCGATATGGTAGTTTTGGAGAAATTATAAATGGTTATNTGGCTGGC
                      ____________________________________________________________
consensus CCTAAGAAATTAATGCGATATGGTAGTTTTGGAGAAATTATAAATGGTTATCTGGCTGGC
 
. : . : . : . : . : . :
JMFS109G07+ TAATTGTGTGGATTAAGAAAGTTGGTGGTGGGTTGCAGTTGAGAAGGGTTCAGTTTCCTT
JMFF020H15+ TAATTGTGTGGATTAAGAAAGTTGGTGGTGGGTTGCAGTTGAGAAGGGTTCAGTTTCCTT
JMFF003O06+ TAATTGTGTGGATTAAGAAAGTTGGTGGTGGGTTGCAGTTGAGAAGGGTTCAGTTTCCTT
                      ____________________________________________________________
consensus TAATTGTGTGGATTAAGAAAGTTGGTGGTGGGTTGCAGTTGAGAAGGGTTCAGTTTCCTT
 
. : . : . : . : . : . :
JMFS109G07+ TCTACATCACAGACTTTAATCAAAAACGAAAAAAAAC-AAAAAAAAATTGGATCTTTCAA
JMFF020H15+ TNTACATCACAGACTTTAATCAAAAACGAAAAAAAACAAAAAAAAAATTGGATCTTTCAA
JMFF003O06+ TNTACATCACAGACTTTAATCAAAAACGAAAAAAAACAAAAAAAAAATTGGATCTTTCAA
                      ____________________________________________________________
consensus TCTACATCACAGACTTTAATCAAAAACGAAAAAAAACAAAAAAAAAATTGGATCTTTCAA
 
. : . : . : . : . : . :
JMFS109G07+ GAAAATCTGGGGAAAAAAATGGAGACTGGGTGTGAATGGAAGCAAAATCTACGGGTCAAG
JMFF020H15+ GAAAATCTGGGGAAAAAAATGGAGACTGGGTGTGAATGGAAGCAAAATCTACGGGTCAAG
JMFF003O06+ GAAAATCTGGGGAAAAAAATGGAGACTGGGTGTGAATGGAAGCAAAATCTACGGGTCAAG
                      ____________________________________________________________
consensus GAAAATCTGGGGAAAAAAATGGAGACTGGGTGTGAATGGAAGCAAAATCTACGGGTCAAG
 
. : . : . : . : . : . :
JMFS109G07+ TGGACTAAAGGA
JMFF020H15+ TGGACTAAAGGAGGATTATTCTGCTAAGTATTACTGTAACAATTAAGAAGAGCAGTATAC
JMFF003O06+ TGGACTAAAGGAGGATTATTCTGCTAAGTATTACTGTAACAATTAAGAAGAGCAGTATAC
                      ____________________________________________________________
consensus TGGACTAAAGGAGGATTATTCTGCTAAGTATTACTGTAACAATTAAGAAGAGCAGTATAC