Previous Contig 000161:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003O04Sequence640000161 (3)gb:OSJN00132_16954181e-46Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03, complete seque708000161 (3)gb:OSJN00132_16954181e-46Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03, complete seque
JMFN033A12Sequence598000161 (3)gb:OSJN00132_16954189e-47Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003O04- GTCATGTTCATATGACTAAAATAGGTACAAGAAAT
                      ____________________________________________________________
consensus GTCATGTTCATATGACTAAAATAGGTACAAGAAAT
 
. : . : . : . : . : . :
rJMFF003O04- TTACATGGTTTGCAGCAAGATAGGTGAAGATCAATCCCCTTTGTTGACACAACTCTCCAG
                      ____________________________________________________________
consensus TTACATGGTTTGCAGCAAGATAGGTGAAGATCAATCCCCTTTGTTGACACAACTCTCCAG
 
. : . : . : . : . : . :
rJMFF003O04- CCACCAAAAAGGGAGAATATTTGTTCCATTAGACAGCACAATACATACTGGCAAACACCT
                      ____________________________________________________________
consensus CCACCAAAAAGGGAGAATATTTGTTCCATTAGACAGCACAATACATACTGGCAAACACCT
 
. : . : . : . : . : . :
rJMFF003O04- ACCAAAAGACTTCCCAATCTTCCAATGGAAAATAGAATATCTTCAATAGTCTTTCTTCCC
                      ____________________________________________________________
consensus ACCAAAAGACTTCCCAATCTTCCAATGGAAAATAGAATATCTTCAATAGTCTTTCTTCCC
 
. : . : . : . : . : . :
rJMFF003O04- ACTTAATGGTGCTTTCTTTAATGAACATACCGATAAGTTGATAAAATGCAATTGTTTGCA
JMFN033A12+ TTAATGAACATACCGATAAGTTGATAAAATGCAATTGTTTGCA
                      ____________________________________________________________
consensus ACTTAATGGTGCTTTCTTTAATGAACATACCGATAAGTTGATAAAATGCAATTGTTTGCA
 
. : . : . : . : . : . :
rJMFF003O04- TAAATCTCTGCTATTTCCGGTGAGTAAGGAGGATTAGTATAATCCTCACAAACTTTTGGA
JMFN033A12+ TAAATCTCTGCTATTTCCGGTGAGTAAGGAGGATTAGTATAATCCTCACAAACTTTTGGA
JMFF003O04+ TGAGTAAGGAGGATTAGTATAATCCTCACAAACTTTTGGA
                      ____________________________________________________________
consensus TAAATCTCTGCTATTTCCGGTGAGTAAGGAGGATTAGTATAATCCTCACAAACTTTTGGA
 
. : . : . : . : . : . :
rJMFF003O04- ACTCTCTTGTGACGATTTGTATATGCGGAATGCAGCAATACACATTGTGGCGTTACCAAT
JMFN033A12+ ACTCTCTTGTGACGATTTGTATATGCGGAATGCAGCAATACACATTGTGGCGTTACCAAT
JMFF003O04+ ACTCTCTTGTGACGATTTGTATATGCGGAATGCAGCAATACACATTGTGGCGTTACCAAT
                      ____________________________________________________________
consensus ACTCTCTTGTGACGATTTGTATATGCGGAATGCAGCAATACACATTGTGGCGTTACCAAT
 
. : . : . : . : . : . :
rJMFF003O04- CACAGTCAAAGCTGCTTGAAGAGCCACTAAAACCTCGAGAGACTCGGAGTTATAGAAGAA
JMFN033A12+ CACAGTCAAAGCTGCTTGAAGAGCCACTAAAACCTCGAGAGACTCGGAGTTATAGAAGAA
JMFF003O04+ CACAGTCAAAGCTGCTTGAAGAGCCACTAAAACCTCGAGAGACTCGGAGTTATAGAAGAA
                      ____________________________________________________________
consensus CACAGTCAAAGCTGCTTGAAGAGCCACTAAAACCTCGAGAGACTCGGAGTTATAGAAGAA
 
. : . : . : . : . : . :
rJMFF003O04- ATGCCATGTGCAGGCACAAAATGCTCCACCTAGCAACGGCACCATACCCCATGATAGCCC
JMFN033A12+ ATGCCATGTGCAGGCACAAAATGCTCCACCTAGCAACGGCACCATACCCCATGATAGCCC
JMFF003O04+ ATGCCATGTGCAGGCACAAAATGCTCCACCTAGCAACGGCACCATACCCCATGATAGCCC
                      ____________________________________________________________
consensus ATGCCATGTGCAGGCACAAAATGCTCCACCTAGCAACGGCACCATACCCCATGATAGCCC
 
. : . : . : . : . : . :
rJMFF003O04- CTTCCAAGATTCATATCCTGACTTCTCCCCGTATTGCCAAACCAAAGCCATTGCAATAAC
JMFN033A12+ CTTCCAAGATTCATATCCTGACTTCTCCCCGTATTGCCAAACCAAAGCCATTGCAATAAC
JMFF003O04+ CTTCCAAGATTCATATCCTGACTTCTCCCCGTATTGCCAAACCAAAGCCATTGCAATAAC
                      ____________________________________________________________
consensus CTTCCAAGATTCATATCCTGACTTCTCCCCGTATTGCCAAACCAAAGCCATTGCAATAAC
 
. : . : . : . : . : . :
rJMFF003O04- CCATTCAATAACACTGGAAACATGAATAGTCCAGGTGGGTAAAGACAGAGCATTGGCAGG
JMFN033A12+ CCATTCAATAACACTGGAAACATGAATAGTCCAGGTGGGTAAAGACAGAGCATTGGCAGG
JMFF003O04+ CCATTCAATAACACTGGAAACATGAATAGTCCAGGTGGGTAAAGACAGAGCATTGGCAGG
                      ____________________________________________________________
consensus CCATTCAATAACACTGGAAACATGAATAGTCCAGGTGGGTAAAGACAGAGCATTGGCAGG
 
. : . : . : . : . : . :
rJMFF003O04- TTCAGCAAACTGCACAGAGGATGAAGCCATTGCAGCTTGCTCGGCAGCAGAAGCAGGTCC
JMFN033A12+ TTCAGCAAACTGCACAGAGGATGAAGCCATTGCAGCTTGCTCGGCAGCAGAAGCAGGTCC
JMFF003O04+ TTCAGCAAACTGCACAGAGGATGAAGCCATTGCAGCTTGCTCGGCAGCAGAAGCAGGTCC
                      ____________________________________________________________
consensus TTCAGCAAACTGCACAGAGGATGAAGCCATTGCAGCTTGCTCGGCAGCAGAAGCAGGTCC
 
. : . : . : . : . : . :
rJMFF003O04- GGATATGGAGATT
JMFN033A12+ GGATATGGAGATTAAAGCAAGACCAGCAACCCCCAAAACCGTAGCGAGGGTTTTTTGGTT
JMFF003O04+ GGATATGGAGATTAAAGCAAGACCAGCAACCCCCAAAACCGTAGCGAGGGTTTTTTGGTT
                      ____________________________________________________________
consensus GGATATGGAGATTAAAGCAAGACCAGCAACCCCCAAAACCGTAGCGAGGGTTTTTTGGTT
 
. : . : . : . : . : . :
JMFN033A12+ ATTGAAATCAATGGGGGGTATTGGGTGGAAAACAGCAGAAAGAAAAGTTGGGGATTTTGT
JMFF003O04+ ATTGAAATCAATGGGGGGTATTGGGTGGAAAACAGCAGAAAGAAAAGTTGGGGATTTTGT
                      ____________________________________________________________
consensus ATTGAAATCAATGGGGGGTATTGGGTGGAAAACAGCAGAAAGAAAAGTTGGGGATTTTGT
 
. : . : . : . : . : . :
JMFN033A12+ GACTGAGGAAAGTTG
JMFF003O04+ GACTGAGGAAAGTTGGGTTTGTTTGGGCTTAGGGAAAGGTAGGAACTTTGAAGGAGATAA
                      ____________________________________________________________
consensus GACTGAGGAAAGTTGGGTTTGTTTGGGCTTAGGGAAAGGTAGGAACTTTGAAGGAGATAA
 
. : . : . : . : . : . :
JMFF003O04+ TAAGGTTAGAACTGCCATCTTTTGATATCTTGAAAGCTTTGTTGCTGAAATGAAGATGTC
                      ____________________________________________________________
consensus TAAGGTTAGAACTGCCATCTTTTGATATCTTGAAAGCTTTGTTGCTGAAATGAAGATGTC