Previous Contig 000159:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003M24Sequence559000159 (4)gb:AB121973_15280215e-30Brassica rapa MLPK mRNA for protein kinase, complete cds.
JMFF009M05Sequence519000159 (4)gb:AB121973_15280211e-23Brassica rapa MLPK mRNA for protein kinase, complete cds.
JMFF048L20Sequence448000159 (4)gb:AB121973_15280211e-11Brassica rapa MLPK mRNA for protein kinase, complete cds.438021841
JMSF023F04Sequence673000159 (4)gb:AK118585_18165542e-77Arabidopsis thaliana At2g28930 mRNA for putative protein kinase, complete cds, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023F04+ GCAAGCCCTTTAGCAGCTCCAA
                      ____________________________________________________________
consensus GCAAGCCCTTTAGCAGCTCCAA
 
. : . : . : . : . : . :
JMSF023F04+ GAGCAACTTTCAAACGCAGATACCAAGAGAGAGGTTGGAAATACGAGCCCCTCCTGAACA
                      ____________________________________________________________
consensus GAGCAACTTTCAAACGCAGATACCAAGAGAGAGGTTGGAAATACGAGCCCCTCCTGAACA
 
. : . : . : . : . : . :
JMSF023F04+ AATGGTTCTCCAAACTACCCTTGGGCATAAACTCATACACCAAAAGACGATGTTCATCCT
                      ____________________________________________________________
consensus AATGGTTCTCCAAACTACCCTTGGGCATAAACTCATACACCAAAAGACGATGTTCATCCT
 
. : . : . : . : . : . :
JMSF023F04+ CTAAACAATACCCAATCAGTTTCACAAGATTCGGATGACAAAACTGCCCCAAATAGTTCA
                      ____________________________________________________________
consensus CTAAACAATACCCAATCAGTTTCACAAGATTCGGATGACAAAACTGCCCCAAATAGTTCA
 
. : . : . : . : . : . :
JMSF023F04+ CTTCTGCCAGCCATTCTCTGTGCCCCTGAAAACCTTCTTGGTTTAACCGCTTTACCGCAA
JMFF003M24+ TTTAACCGCTTTACCGCAA
                      ____________________________________________________________
consensus CTTCTGCCAGCCATTCTCTGTGCCCCTGAAAACCTTCTTGGTTTAACCGCTTTACCGCAA
 
. : . : . : . : . : . :
JMSF023F04+ CTACTATGCCAGTACCAGGCCTAGATGCAGCTAGCGAGTTCTCATCAAGCCAGCCCTTAT
JMFF009M05+ TAGATGCAGCTAGCGAGTTCTCATCAAGCCAGCCCTTAT
JMFF003M24+ CTACTATGCCAGTACCAGGCCTAGATGCAGCTAGCGAGTTCTCATCAAGCCAGCCCTTAT
                      ____________________________________________________________
consensus CTACTATGCCAGTACCAGGCCTAGATGCAGCTAGCGAGTTCTCATCAAGCCAGCCCTTAT
 
. : . : . : . : . : . :
JMSF023F04+ AAACCGACCCGAATCCACCTTCTCCCAGCACACTATCGGGACGGAAGTTCCTGGTGGCCA
JMFF009M05+ AAACCGACCCGAATCCACCTTCTCCCAGCACACTATCGGGACGGAAGTTCCTGGTGGCCA
JMFF048L20+ CTATCGGGACGGAAGTTCCTGGTGGCCA
JMFF003M24+ AAACCGACCCGAATCCACCTTCTCCCAGCACACTATCGGGACGGAAGTTCCTGGTGGCCA
                      ____________________________________________________________
consensus AAACCGACCCGAATCCACCTTCTCCCAGCACACTATCGGGACGGAAGTTCCTGGTGGCCA
 
. : . : . : . : . : . :
JMSF023F04+ TTCTTAGATCAGCAAACGTAAAGCGTTTCAGATTGGGGGACTGCAAGATCTCCCCCTCAC
JMFF009M05+ TTCTTAGATCAGCAAACGTAAAGCGTTTCAGATTGGGGGACTGCAAGATCTCCCCCTCAC
JMFF048L20+ TTCTTAGATCAGCAAACGTAAAGCGTTTCAGATTGGGGGACTGCAAGATCTCCCCCTCAC
JMFF003M24+ TTCTTAGATCAGCAAACGTAAAGCGTTTCAGATTGGGGGACTGCAAGATCTCCCCCTCAC
                      ____________________________________________________________
consensus TTCTTAGATCAGCAAACGTAAAGCGTTTCAGATTGGGGGACTGCAAGATCTCCCCCTCAC
 
. : . : . : . : . : . :
JMSF023F04+ TCCTGGGAGTTGGTAGCACAGAACTGCTACTTGAATTTTTCGAATCACTCCCTTCTGCGC
JMFF009M05+ TCCTGGGAGTTGGTAGCACAGAACTGCTACTTGAATTTTTCGAATCACTCCCTTCTGCGC
JMFF048L20+ TCCTGGGAGTTGGTAGCACAGAACTGCTACTTGAATTTTTCGAATCACTCCCTTCTGCGC
JMFF003M24+ TCCTGGGAGTTGGTAGCACAGAACTGCTACTTGAATTTTTCGAATCACTCCCTTCTGCGC
                      ____________________________________________________________
consensus TCCTGGGAGTTGGTAGCACAGAACTGCTACTTGAATTTTTCGAATCACTCCCTTCTGCGC
 
. : . : . : . : . : . :
JMSF023F04+ TAACATATTTCGAGCTTAGCCCTGTATTAGGAGGACTTTCAGCTTTGATTCTGGCACTCA
JMFF009M05+ TAACATATTTCGAGTTTAGCCCTGTATTAGGAGGACTTTCAGCTTTGATTCTGGCACTCA
JMFF048L20+ TAACATATTTCGAGTTTAGCCCTGTATTAGGAGGACTTTCAGCTTTGATTCTGGCACTCA
JMFF003M24+ TAACATATTTCGAGTTTAGCCCTGTATTAGGAGGACTTTCAGCTTTGATTCTGGCACTCA
                      ____________________________________________________________
consensus TAACATATTTCGAGTTTAGCCCTGTATTAGGAGGACTTTCAGCTTTGATTCTGGCACTCA
 
. : . : . : . : . : . :
JMSF023F04+ AGCAAATACCCATCAGAAAAGACCAGGCTTTACTCACTATCTTCTTCACCAAACTTAATT
JMFF009M05+ AGCAAATACCCATCAGAAAAGACCAGGCTTTACTCACTATCTTCTTCACCAAACTTAATT
JMFF048L20+ AGCAAATACCCATCAGAAAAGACCAGGCTTTACTCACTATCTTCTTCACCAAACTTAATT
JMFF003M24+ AGCAAATACCCATCAGAAAAGACCAGGCTTTACTCACTATCTTCTTCACCAAACTTAATT
                      ____________________________________________________________
consensus AGCAAATACCCATCAGAAAAGACCAGGCTTTACTCACTATCTTCTTCACCAAACTTAATT
 
. : . : . : . : . : . :
JMSF023F04+ TTTTGCTCTCTTTCTCTTCCTCAGAGAACAAGAACAACCCAGCTCAGCTC
JMFF009M05+ TTTTGCTCTCTTTCTCTTCCTCAGAGAACAAGAACAACCCAGCTCAGCTCAGCCCTGATT
JMFF048L20+ TTTTGCTCTCTTTCTCTTCCTCAGAGAACAAGAACAACCCAGCTCAGCTCAGCCCTGATT
JMFF003M24+ TTTTGCTCTCTTTCTCTTCCTCAGAGAACAAGAACAACCCAGCTCAGCTCAGCCCTGATT
                      ____________________________________________________________
consensus TTTTGCTCTCTTTCTCTTCCTCAGAGAACAAGAACAACCCAGCTCAGCTCAGCCCTGATT
 
. : . : . : . : . : . :
JMFF009M05+ ATGATTTGATCTTTATCTTTAAGAGAAGGGATTAGAGGAGTAAATGGCTGCTTTTCAGAG
JMFF048L20+ ATGATTTGATCTTTATCTTTAAGAGAAGGGATTAGAGGAGTAAATGGCTGCTTTTCAGAG
JMFF003M24+ ATGATTTGATCTTTATCTTTAAGAGAAGGGATTAGAGGAGTAAATGGCTGCTTTTCAGAG
                      ____________________________________________________________
consensus ATGATTTGATCTTTATCTTTAAGAGAAGGGATTAGAGGAGTAAATGGCTGCTTTTCAGAG
 
. : . : . : . : . : . :
JMFF009M05+ GTTTCCATGAAGAAGCTGATGATAGAAAGAGGGGACGAGCTTTTGTTTGACGGTTTGACT
JMFF048L20+ GTTTCCATGAAGAAGCTGATGATAGAAAGAGGGGACGAGCTTTTGTTTGACGGTTTGACT
JMFF003M24+ GTTTCCATGAAGAAGCTGATGATAGAAAGAGGGGACGAGCTTTTGTTTGACGGTTTGACT
                      ____________________________________________________________
consensus GTTTCCATGAAGAAGCTGATGATAGAAAGAGGGGACGAGCTTTTGTTTGACGGTTTGACT