Previous Contig 000152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003L08Sequence525000152 (2)gb:AE005172_8902861e-30Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951732008287 (2)gb:OSJN00203_16966514e-40Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0032E06, complete seque
JMFF032A03Sequence569000152 (2)gb:AE005172_8902861e-30Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951747008287 (2)gb:OSJN00203_16966513e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0032E06, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032A03+ CATTCTGACGCGTGTCCGAGCCATAATCACCACTCTCTCCATCACTT
                      ____________________________________________________________
consensus CATTCTGACGCGTGTCCGAGCCATAATCACCACTCTCTCCATCACTT
 
. : . : . : . : . : . :
JMFF032A03+ CCGGAGCTCGAATTCCCACCGCTCCAATTACCGGAGCTACGGCGGGAATTCAGGTTTTCA
JMFF003L08+ CCACCGCTCCAATTACCGGAGCTACGNCGGGAATTCAGGTTTTCA
                      ____________________________________________________________
consensus CCGGAGCTCGAATTCCCACCGCTCCAATTACCGGAGCTACGGCGGGAATTCAGGTTTTCA
 
. : . : . : . : . : . :
JMFF032A03+ GGCGAACTTGGCAGCTGGTTCCGCCGTCTATACTCCAGGCAAACACAAACTATGTGGAGC
JMFF003L08+ GGCGAACTTGGCAGCTGGTTCCGCCGTCTATACTCCAGGCAAACACAAACTATGTGGAGC
                      ____________________________________________________________
consensus GGCGAACTTGGCAGCTGGTTCCGCCGTCTATACTCCAGGCAAACACAAACTATGTGGAGC
 
. : . : . : . : . : . :
JMFF032A03+ ACACACTGGAAATCATACCCGACAATCCAGAGCCTGAGCGGCATCATAGGGGACTCGTCA
JMFF003L08+ ACACACTGGAAATCATACCCGACAATCCAGAGCCTGAGCGGCATCATAGGGGACTCGTCA
                      ____________________________________________________________
consensus ACACACTGGAAATCATACCCGACAATCCAGAGCCTGAGCGGCATCATAGGGGACTCGTCA
 
. : . : . : . : . : . :
JMFF032A03+ CGGCTCATCACTAGCACGGATATCGAGACGAGGACGAAAGCTAAATTCCAGAAGAGATCG
JMFF003L08+ CGGCTCATCACTAGCACGGATATCGAGACGAGGACGAAAGCTAAATTCCAGAAGAGATCG
                      ____________________________________________________________
consensus CGGCTCATCACTAGCACGGATATCGAGACGAGGACGAAAGCTAAATTCCAGAAGAGATCG
 
. : . : . : . : . : . :
JMFF032A03+ AGAAGCACAATAGGTTTGGAGTAGGCCCAATCGCTCTGCCTCTCCTCGATTTGCTCGGCC
JMFF003L08+ AGAAGCACAATAGGTTTGGAGTAGGCCCAATCGCTCTGCCTCTCCTCGATTTGCTCGGCC
                      ____________________________________________________________
consensus AGAAGCACAATAGGTTTGGAGTAGGCCCAATCGCTCTGCCTCTCCTCGATTTGCTCGGCC
 
. : . : . : . : . : . :
JMFF032A03+ GCCGACTCGCGCACCCGCATAGACGGCTCGCGCATCATCCTCCGGCTGCTAGCGCGCCTG
JMFF003L08+ GCCGACTCGCGCACCCGCATAGACGGCTCGCGCATCATCCTCCGGCTGCTAGCGCGCCTG
                      ____________________________________________________________
consensus GCCGACTCGCGCACCCGCATAGACGGCTCGCGCATCATCCTCCGGCTGCTAGCGCGCCTG
 
. : . : . : . : . : . :
JMFF032A03+ AGGAAGCGAGCCGCCCCTCGTAGGCTAGGCGGACGGCGCATAAATCTTCGGCTTCCAAAG
JMFF003L08+ AGGAAGCGAGCCGCCCCTCGTAGGCTAGGCGGACGGCGCATAAATCTTCGGCTTCCAAAG
                      ____________________________________________________________
consensus AGGAAGCGAGCCGCCCCTCGTAGGCTAGGCGGACGGCGCATAAATCTTCGGCTTCCAAAG
 
. : . : . : . : . : . :
JMFF032A03+ ATCTGGTCGCCCAGCAAAGGTGTCGTATCGACTCCATCGTTACCTTCCCCGCCGGAATTA
JMFF003L08+ ATCTGGTCGCCCAGCAAAGGTGTCGTATCGACTCCATCGTTACCTTCCCCGCCGGAATTA
                      ____________________________________________________________
consensus ATCTGGTCGCCCAGCAAAGGTGTCGTATCGACTCCATCGTTACCTTCCCCGCCGGAATTA
 
. : . : . : . : . : . :
JMFF032A03+ ACGTTCACGTTGGTAGTGTCGTCGTCCGGAGCTCTCGCCAT
JMFF003L08+ ACGTTCACGTTGGTAGTGTCGTCGTCCGGAGCTCTCGCCATTGGAGTAATCGCCAATAAT
                      ____________________________________________________________
consensus ACGTTCACGTTGGTAGTGTCGTCGTCCGGAGCTCTCGCCATTGGAGTAATCGCCAATAAT