Previous Contig 000148:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I24Sequence579000148 (26)gb:AB026909_15174195e-67Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,689000148 (26)sp|P22778|ATPO_IPOBA3e-67ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF004H18Sequence590000148 (26)gb:AB026909_15174197e-81Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,782000148 (26)sp|P22778|ATPO_IPOBA2e-83ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF009F08Sequence578000148 (26)gb:AB026909_15174192e-79Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,654000148 (26)sp|P22778|ATPO_IPOBA1e-64ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF026P02Sequence534000148 (26)gb:AB026909_15174199e-71Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,746000148 (26)sp|P22778|ATPO_IPOBAe-104ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF049F16Sequence619000148 (26)gb:AB026909_15174193e-79Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,612000148 (26)sp|P22778|ATPO_IPOBA3e-65ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF049P14Sequence616000148 (26)sp|P22778|ATPO_IPOBA2e-85ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens603000148 (26)sp|P22778|ATPO_IPOBA9e-42ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFF051C05Sequence649000148 (26)sp|P22778|ATPO_IPOBA7e-85ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens596000148 (26)sp|P22778|ATPO_IPOBA5e-64ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFN032G20Sequence614000148 (26)sp|P22778|ATPO_IPOBAe-102ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMFN034E11Sequence496000148 (26)gb:AB026909_15174191e-24Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,
JMFN045P09Sequence632000148 (26)gb:AB026909_15174196e-76Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,
JMFN045P13Sequence570000148 (26)gb:AB026909_15174191e-60Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,
JMSF009B08Sequence228000148 (26)gb:AB026910_15174201e-06Ipomoea batatas F1-delta-2 gene for mitochondrial F1-ATP synthase delta subunit,629000148 (26)gb:AB026909_15174191e-55Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,
JMSF035L01Sequence681000148 (26)sp|P22778|ATPO_IPOBA2e-90ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens713000148 (26)sp|P22778|ATPO_IPOBAe-103ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMSF040P08Sequence651000148 (26)sp|P22778|ATPO_IPOBA4e-92ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens861000148 (26)sp|P22778|ATPO_IPOBAe-103ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens
JMSF044B15Sequence634000148 (26)gb:AB026909_15174194e-82Ipomoea batatas F1-delta-1 gene for mitochondrial F1-ATP synthase delta subunit,683000148 (26)sp|P22778|ATPO_IPOBA3e-98ATP synthase delta chain, mitochondrial precursor (EC 3.6.3.14) (Oligomycin sens

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034E11+ AAACT
rJMFF049P14- GAAACT
                      ____________________________________________________________
consensus GAAACT
 
. : . : . : . : . : . :
JMFN034E11+ CAGAAAATACTT-GGTTGGTCACTGCAGGGTCAGAAGTTTTATTCTGTAGAATATGTTTT
rJMFF049P14- CAGAAAATACTTNGGTTGGTCACTGCAGGGTCAGAAGTTTTATTCTGTAGAATATGTTTT
rJMFF009F08- TGTTTT
rJMFF003I24- ATTCTGTAGAATATGTTTT
rJMFF004H18- ATTCTGTAGAATATGTTTT
rJMSF040P08- TGTTTT
                      ____________________________________________________________
consensus CAGAAAATACTTNGGTTGGTCACTGCAGGGTCAGAAGTTTTATTCTGTAGAATATGTTTT
 
. : . : . : . : . : . :
JMFN034E11+ GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
rJMFF049P14- GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
rJMFF009F08- GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
rJMFF003I24- GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
rJMFF004H18- GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
rJMFF049F16- GCAAA
rJMSF040P08- GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
                      ____________________________________________________________
consensus GTAGGGATAAATAATGCTTTGCTGTATCTTGAAAAGTTATGGATCAAAGATGTCAGCAAA
 
. : . : . : . : . : . :
JMFN034E11+ GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF049P14- GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF009F08- GTAAAAACAACATTA-CGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF003I24- GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMSF009B08- TTTTTTTCCATCAAATTCTTACAAAAAGCANGTT
rJMFF004H18- GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF049F16- GTAAAAACAACATTAGGGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF051C05- TTCTTACAAAAAGCAAGTT
rJMSF040P08- GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
rJMFF026P02- AAGTT
                      ____________________________________________________________
consensus GTAAAAACAACATTA-GGTTTTCTTTTTTTTTCCCATCAAATTCTTACAAAAAGCAAGTT
 
. : . : . : . : . : . :
JMFN034E11+ TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMFF049P14- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMFF009F08- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMFF003I24- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMSF009B08- TTCTTTATTNGCAAAAAAANACCATAATAAGGTTTTATCGGAAAACAGGCNGCTCANGGA
rJMFF004H18- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMFF049F16- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMFF051C05- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMSF040P08- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMSF035L01- ATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
rJMSF044B15- AATGTTTTATCGGAAAACAGGCAGCTCANGGA
rJMFF026P02- TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
                      ____________________________________________________________
consensus TTCTTTATTTGCAAAAAAAGACCATAATAATGTTTTATCGGAAAACAGGCAGCTCAAGGA
 
. : . : . : . : . : . :
JMFN034E11+ GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF049P14- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF009F08- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF003I24- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMSF009B08- GCCCANACCGAATTCGGGTTTTCCTCAANANGGAAACAAAACAAACNCCTTCTAACGGGA
rJMFF004H18- GCCCANACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF049F16- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF051C05- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMSF040P08- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMSF035L01- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMSF044B15- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
rJMFF026P02- GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
                      ____________________________________________________________
consensus GCCCAGACCGAATTCGTGTTTTCCTCAAGATGGAAACAAAACAAACACCTTCTAACGGGA
 
. : . : . : . : . : . :
JMFN034E11+ TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF049P14- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF009F08- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF003I24- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMSF009B08- TNGGAGGCTCTCAAAAGTTGAGNGGTTCACGCAANAATCTCTCCATCNGGNGNGCCCNAG
rJMFF004H18- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF049F16- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF051C05- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMSF040P08- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMSF035L01- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMSF044B15- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
rJMFF026P02- TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
                      ____________________________________________________________
consensus TTGGAGGCTCTCAAAAGTTGAGTGGTTCACGCAAGAATCTCTCCATCTGGCGTGCCCGAG
 
. : . : . : . : . : . :
JMFN034E11+ TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMFF049P14- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMFF009F08- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMFF003I24- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMSF009B08- TCTTTATANACNTGTCAAANACTTTCNGACNGAATTCCACAACANGGCCNCCAANAANGG
rJMFF004H18- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAANAATGG
rJMFF049F16- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMFF051C05- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMSF040P08- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMSF035L01- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMSF044B15- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
rJMFF026P02- TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
JMFN032G20+ CAAGAATGG
                      ____________________________________________________________
consensus TCTTTATAGACATGTCAAAGACTTTCTGACTGAATTCCACAACAAGGCCACCAAGAATGG
 
. : . : . : . : . : . :
JMFN034E11+ ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF049P14- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF009F08- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF003I24- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMSF009B08- ANGGATCAANCTTCNGTTCAATTTGAACACTCTTTCCCNGTCCAACCATTTCCNGCAANG
rJMFF004H18- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF049F16- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF051C05- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMSF040P08- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMSF035L01- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMSF044B15- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
rJMFF026P02- ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
JMFN032G20+ ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
                      ____________________________________________________________
consensus ATGGATCAATCTTCTGTTCAATTTGAACACTCTTTCCCTGTCCAACCATTTCCTGCAATG
 
. : . : . : . : . : . :
JMFN034E11+ TGGCTTTCAATTC
rJMFF049P14- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMFF009F08- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMFF003I24- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMSF009B08- NGGCTTTCAATTCTTTCNCCTCATCAGCAGGAAGGGNAATTACNGTTGTCA-CAANGGCT
rJMFF004H18- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMFF049F16- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMFF051C05- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMSF040P08- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMSF035L01- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMSF044B15- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
rJMFF026P02- TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
JMFN032G20+ TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
JMSF040P08+ TCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
JMFF049P14+ CTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
JMFF051C05+ AGGAAGGGGAATTACTG-TGTCACCAATGGCT
JMSF035L01+ TTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
                      ____________________________________________________________
consensus TGGCTTTCAATTCTTTCTCCTCATCAGCAGGAAGGGGAATTACTGTTGTCA-CAATGGCT
 
. : . : . : . : . : . :
rJMFF049P14- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCAC-ATGCGATCTA
rJMFF009F08- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMFF003I24- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMSF009B08- TTGACTTCN-CCCCNGNGNGCCANGGNCAGCTCTTTGAATCGCT-TCACAANGCGATCTA
rJMFF004H18- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMFF049F16- TCGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMFF051C05- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMSF040P08- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMSF035L01- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMSF044B15- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
rJMFF026P02- TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFN032G20+ TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMSF040P08+ TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFF049F16+ GTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFF049P14+ TTGACTTCTCCCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFF051C05+ TGACTTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFF009F08+ CCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFF004H18+ GTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMSF035L01+ TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMSF044B15+ TCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
JMFN045P09+ GTGCCATGGTCAGCTC-TTGAATCGCTNTCACAATGCGATCTA
                      ____________________________________________________________
consensus TTGACTTCT-CCCCTGTGTGCCATGGTCAGCTCTTTGAATCGCT-TCACAATGCGATCTA
 
. : . : . : . : . : . :
rJMFF049P14- TG
rJMFF009F08- TGTGTTTCAGCCTGCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMFF003I24- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMSF009B08- TGNGTTTCANCCTCCCATTTTCAGCCAAAACAAGCAANAAGTTCNGGGGGGNATCCCCAA
rJMFF004H18- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMFF049F16- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMFF051C05- TGTGTTTTAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMSF040P08- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMSF035L01- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMSF044B15- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
rJMFF026P02- TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFN032G20+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMSF040P08+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF049F16+ TGTGTNTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF049P14+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF051C05+ TGTGTTTNAGCCTCCCATTTNCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF009F08+ TGTGTTTCAGCCTGCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF026P02+ TTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF004H18+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMSF035L01+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMSF044B15+ TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFN045P09+ TGTGTNTCAGCCTCCCATTNTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFN045P13+ TCAGCCAAATCAAGCAAGAAGTTCTGGGTGGTATCCCCAA
JMFF003I24+ TCAGCCAAAACNAGCAAGAAGTTCTGGGTGGTATCCCCAA
                      ____________________________________________________________
consensus TGTGTTTCAGCCTCCCATTTTCAGCCAAAACAAGCAAGAAGTTCTGGGTGGTATCCCCAA
 
. : . : . : . : . : . :
rJMFF009F08- ATTTAGCTTGAGCANAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGG
rJMFF003I24- ATTTAGCTTGAGCANAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
rJMSF009B08- ATTTAGCTNGAGCAAAAATTTCCTTTANGGCATTCACTCT-AGTATCAACAGGTACAGAN
rJMFF004H18- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
rJMFF049F16- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCTNAGTATC-ACAGGTACAGAT
rJMFF051C05- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATC-ACAGGTACAGAT
rJMSF040P08- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
rJMSF035L01- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
rJMSF044B15- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
rJMFF026P02- ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFN032G20+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMSF040P08+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF049F16+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF049P14+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF051C05+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF009F08+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF026P02+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF004H18+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMSF035L01+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMSF044B15+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFN045P09+ ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFN045P13+ ATCTAGCTTGAGCAGAAATATCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
JMFF003I24+ ATTTAGCNTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
                      ____________________________________________________________
consensus ATTTAGCTTGAGCAGAAATTTCCTTTATGGCATTCACTCT-AGTATCAACAGGTACAGAT
 
. : . : . : . : . : . :
rJMFF003I24- GGATCCTT
rJMSF009B08- GGATCCTTCANGAACTGANAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATA
rJMFF004H18- GGATCCTTCATGAACTGANAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAN
rJMFF049F16- GGATCCTTC
rJMFF051C05- GGATCCTTCATGAACTG
rJMSF040P08- GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
rJMSF035L01- GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
rJMSF044B15- GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
rJMFF026P02- GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFN032G20+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMSF040P08+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF049F16+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF049P14+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF051C05+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF009F08+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF026P02+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFF004H18+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMSF035L01+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMSF044B15+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFN045P09+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
JMFN045P13+ GGATCCTTCATGAACTGAGAAAAGGTAGGCCTCTTCTTGGAAGCCTCAACAAGGTCATAG
JMFF003I24+ GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
                      ____________________________________________________________
consensus GGATCCTTCATGAACTGAGAAAATGTAGGACTCTTCTTTGAAGCCTCAACAAGGTCATAG
 
. : . : . : . : . : . :
rJMFF004H18- AGCTCTGACTCAACCTTCTCTAATGNGTTANACTTTACTGCTGCAAGG
rJMSF040P08- AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
rJMSF035L01- AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
rJMSF044B15- AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTNACTGCTGCNAGGTACAAAGCAGAT
rJMFF026P02- AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFN032G20+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMSF040P08+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF049F16+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF049P14+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF051C05+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF009F08+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF026P02+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFF004H18+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMSF035L01+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMSF044B15+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFN045P09+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
JMFN045P13+ AGCTCTGACTCATCCTTCTCTAATGTGTTAGACTTTGCTGGTGCAAGGTCCAAAGCAGAT
JMFF003I24+ AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
                      ____________________________________________________________
consensus AGCTCTGACTCAACCTTCTCTAATGTGTTAGACTTTACTGCTGCAAGGTACAAAGCAGAT
 
. : . : . : . : . : . :
rJMSF040P08- GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
rJMSF035L01- GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
rJMSF044B15- GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTT
rJMFF026P02- GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFN032G20+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMSF040P08+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF049F16+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF049P14+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF051C05+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF009F08+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF026P02+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFF004H18+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMSF035L01+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMSF044B15+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFN045P09+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
JMFN045P13+ GCATAGTTTCCAGAAGCCCCATGCATGGTCACAGGCACCTTAATTTTCTGTTTTTTCGAA
JMFF003I24+ GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
                      ____________________________________________________________
consensus GCATAGTTTCCAGAAACCCCATACATTGTCACAGGCACCTTAATTTTTTGTTCTTTTGAA
 
. : . : . : . : . : . :
rJMSF040P08- GCAGAGGCAGTTGCATAGTT
rJMSF035L01- GCANANGCAGTTGCATAGTT
rJMFF026P02- GCAGAGGCAGTTGCATAGTTCCTCA
JMFN032G20+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMSF040P08+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF049F16+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF049P14+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF051C05+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF009F08+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF026P02+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFF004H18+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMSF035L01+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMSF044B15+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFN045P09+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMFN045P13+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
JMSF009B08+ AGAAAT
JMFF003I24+ GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
                      ____________________________________________________________
consensus GCAGAGGCAGTTGCATAGTTCCTCAGCAGCTCAGGGTTGGAGAGGGTAGGGCAGAGAAAT
 
. : . : . : . : . : . :
JMFN032G20+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMSF040P08+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF049F16+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF049P14+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF051C05+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF009F08+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF026P02+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF004H18+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMSF035L01+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMSF044B15+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFN045P09+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFN045P13+ GATCGATGAGCGCTAGATCTCTCGGGTGAAGAGAGGGCCTTTTGGAGAAGAGGGAAGCCC
JMSF009B08+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
JMFF003I24+ GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
                      ____________________________________________________________
consensus GATCGATGAGCGCTAGATCTCTCGGCTGAAGAGAGGGCCTTCTGGAGAAGAGGGAAGCCC
 
. : . : . : . : . : . :
JMFN032G20+ ATCGATCTA
JMSF040P08+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF049F16+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF049P14+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF051C05+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF009F08+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF026P02+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF004H18+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMSF035L01+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMSF044B15+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFN045P09+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFN045P13+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTATAAGCTGAA
JMSF009B08+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
JMFF003I24+ ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
                      ____________________________________________________________
consensus ATCGATCTAGCACGTCCTGCCATTGCCATTTCAGAGAGCTCTTCTTTGCTCTAAGCTGAA
 
. : . : . : . : . : . :
JMSF040P08+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFF049F16+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFF049P14+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTC
JMFF051C05+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGG-TTGAAGAAC
JMFF009F08+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFF026P02+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFF004H18+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMSF035L01+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMSF044B15+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFN045P09+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFN045P13+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGCGAGTCAGAAGGGAAGGG-TAGAAGAAC
JMSF009B08+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
JMFF003I24+ TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
                      ____________________________________________________________
consensus TCGTTCGCCGGCGCGAGAGAGAGAATCCGGAGAGAGTCAGAAGGGAAGGGTTTGAAGAAC
 
. : . : . : . : . : . :
JMFF049F16+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATT
JMFF051C05+ GAAGCCCAAAGAACGCTAC
JMFF004H18+ GAAGCCC
JMSF035L01+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATT
JMSF044B15+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATTGACC
JMFN045P09+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATTGACCACCACTATT
JMFN045P13+ GAAGCCCAAAGAACGCTACAGTTTGCCCCATAGAGACTGACCACCACTATT
JMSF009B08+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATTGACC
JMFF003I24+ GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATTGACCACCACTATTGCTCTCGCT
                      ____________________________________________________________
consensus GAAGCCCAAAGAACGCTACAGTTTACCCTATAGAGATTGACCACCACTATTGCTCTCGCT