Previous Contig 000147:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I15Sequence613000147 (5)gb:AY088570_15735878e-46Arabidopsis thaliana clone 7925 mRNA, complete sequence.782010717 (3)gb:AY088570_1573587e-112Arabidopsis thaliana clone 7925 mRNA, complete sequence.
JMFF047D23Sequence612000147 (5)gb:AY088570_15735878e-59Arabidopsis thaliana clone 7925 mRNA, complete sequence.638010717 (3)gb:AY088570_15735874e-48Arabidopsis thaliana clone 7925 mRNA, complete sequence.
JMSF004O05Sequence262000147 (5)gb:GMA012318_16803334e-04Glycine max cctd gene.213011679 (3)
JMSF045G01Sequence710000147 (5)gb:AY088570_15735877e-66Arabidopsis thaliana clone 7925 mRNA, complete sequence.819010717 (3)gb:AY088570_15735877e-97Arabidopsis thaliana clone 7925 mRNA, complete sequence.
JMSF046E06Sequence759000147 (5)gb:AY088570_15735878e-74Arabidopsis thaliana clone 7925 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046E06+ AAA
                      ____________________________________________________________
consensus AAA
 
. : . : . : . : . : . :
JMSF046E06+ ACCAAACCCTTTACCATCTCAGTATCATCAACCGTACCACCCAATTTCTTCACAATCTTA
JMSF045G01+ CTTCACAATCTTA
                      ____________________________________________________________
consensus ACCAAACCCTTTACCATCTCAGTATCATCAACCGTACCACCCAATTTCTTCACAATCTTA
 
. : . : . : . : . : . :
JMSF046E06+ ATATCTCTTAAATCTACAAGGTCTGGTTTTGCAGGGTCAACAACAGAAAGCACAGAATCA
JMFF047D23+ AGGGTCAACAACAGAAAGCACAGAATCA
JMSF045G01+ ATATCTCTTAAATCTACAAGGTCTGGTTTTGCAGGGTCAACAACAGAAAGCACAGAATCA
                      ____________________________________________________________
consensus ATATCTCTTAAATCTACAAGGTCTGGTTTTGCAGGGTCAACAACAGAAAGCACAGAATCA
 
. : . : . : . : . : . :
JMSF046E06+ ACAGCTAATGGAGCTAAAAGAGTTGAATACTGAGACACTACCTTACTGTTCAGCGCAGTA
JMFF047D23+ ACAGCTAATGGAGCTAAAAGAGTTGAATACTGAGACACTACCTTACTGTTCAGCGCAGTA
JMSF045G01+ ACAGCTAATGGAGCTAAAAGAGTTGAATACTGAGACACTACCTTACTGTTCAGCGCAGTA
JMFF003I15+ GTTCAGCGCAGTA
                      ____________________________________________________________
consensus ACAGCTAATGGAGCTAAAAGAGTTGAATACTGAGACACTACCTTACTGTTCAGCGCAGTA
 
. : . : . : . : . : . :
JMSF046E06+ CTGGCCGATTTGATAAGCGAATCGCGGTCAGAGAGCTCAACAGGAATCGCCATAGCGGTA
JMFF047D23+ CTGGCCGATTTGATAAGCGAATCGCGGTCAGAGAGCTCAACAGGAATCGCCATAGCGGTA
JMSF045G01+ CTGGCCGATTTGATAAGCGAATCGCGGTCAGAGAGCTCAACAGGAATCGCCATAGCGGTA
JMFF003I15+ CTGGCCGATTTGATAAGCGAATCGCGGTCAGAGAGCTCAACAGGAATCGCCATAGCGGTA
                      ____________________________________________________________
consensus CTGGCCGATTTGATAAGCGAATCGCGGTCAGAGAGCTCAACAGGAATCGCCATAGCGGTA
 
. : . : . : . : . : . :
JMSF046E06+ AGGACCTCAACAGCCTTGATAGAAGTCTTATGGAGCGATTCGGAGACAATAGTAGGATGG
JMFF047D23+ AGGACCTCAACAGCCTTGATAGAAGTCTTATGGAGCGATTCGGAGACAATAGTAGGATGG
JMSF045G01+ AGGACCTCAACAGCCTTGATAGAAGTCTTATGGAGCGATTCGGAGACAATAGTAGGATGG
JMFF003I15+ AGGACCTCAACAGCCTTGATAGAAGTCTTATGGAGCGATTCGGAGACAATAGTAGGATGG
                      ____________________________________________________________
consensus AGGACCTCAACAGCCTTGATAGAAGTCTTATGGAGCGATTCGGAGACAATAGTAGGATGG
 
. : . : . : . : . : . :
JMSF046E06+ ATACCTGCTGAAAGAAGGGATAGGCATTGCTTTAGGAGAGCACCAGCAATGACGACGACG
JMFF047D23+ ATACCTGCTGAAAGAAGGGATAGGCATTGCTTTAGGAGAGCACCAGCAATGACGACGACG
JMSF045G01+ ATACCTGCTGAAAGAAGGGATAGGCATTGCTTTAGGAGAGCACCAGCAATGACGACGACG
JMFF003I15+ ATACCTGCTGAAAGAAGGGATAGGCATTGCTTTAGGAGAGCACCAGCAATGACGACGACG
                      ____________________________________________________________
consensus ATACCTGCTGAAAGAAGGGATAGGCATTGCTTTAGGAGAGCACCAGCAATGACGACGACG
 
. : . : . : . : . : . :
JMSF046E06+ GTGGTAGTGCCGTCACCGGCGACGACGTCCTGCGATTTGGAGAGCTCAACGAGGAACTTC
JMFF047D23+ GTGGTAGTGCCGTCACCGGCGACGACGTCCTGCGATTTGGAGAGCTCAACGAGGAACTTC
JMSF045G01+ GTGGTAGTGCCGTCACCGGCGACGACGTCCTGCGATTTGGAGAGCTCAACGAGGAACTTC
JMFF003I15+ GTGGTAGTGCCGTCACCGGCGACGACGTCCTGCGATTTGGAGAGCTCAACGAGGAACTTC
                      ____________________________________________________________
consensus GTGGTAGTGCCGTCACCGGCGACGACGTCCTGCGATTTGGAGAGCTCAACGAGGAACTTC
 
. : . : . : . : . : . :
JMSF046E06+ GCGGCAGGTTGGAGGACTTCCATCTTGTTAAGGATGGTGGCGCCATCGTTGGTGATGATG
JMFF047D23+ GCGGCAGGTTGGAGGACTTCCATCTTGTTAAGGATGGTGGCGCCATCGTTGGTGATGATG
JMSF045G01+ GCGGCAGGTTGGAGGACTTCCATCTTGTTAAGGATGGTGGCGCCATCGTTGGTGATGATG
JMFF003I15+ GCGGCAGGTTGGAGGACTTCCATCTTGTTAAGGATGGTGGCGCCATCGTTGGTGATGATG
                      ____________________________________________________________
consensus GCGGCAGGTTGGAGGACTTCCATCTTGTTAAGGATGGTGGCGCCATCGTTGGTGATGATG
 
. : . : . : . : . : . :
JMSF046E06+ ACCTCGCCATTGGCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
JMFF047D23+ ACCTCGCCATTGGCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
JMSF045G01+ ACCTCGCCATTGGCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
JMSF004O05+ GCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
JMFF003I15+ ACCTCGCCATTGGCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
                      ____________________________________________________________
consensus ACCTCGCCATTGGCCGTGGAGATCATCTTGTCCATTCCTTTGGGGCCAAGACTAGTCCGG
 
. : . : . : . : . : . :
JMSF046E06+ ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
JMFF047D23+ ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
JMSF045G01+ ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
JMSF004O05+ ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
JMFF003I15+ ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
                      ____________________________________________________________
consensus ACGGCATCGGCCACCGCACGAGCCGCCGCGATGTTGGCCATGCGGATATCGTCCTTGCGC
 
. : . : . : . : . : . :
JMSF046E06+ TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
JMFF047D23+ TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
JMSF045G01+ TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
JMSF004O05+ TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
JMFF003I15+ TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
                      ____________________________________________________________
consensus TTGTTGTCCATGAAGGTTTCCGTCTTCGATGAGGACCCGGCGGCGCCTGGGGCAGCGACT
 
. : . : . : . : . : . :
JMSF046E06+ ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCACACTTGAGAGAGAGTGA
JMFF047D23+ ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCAC
JMSF045G01+ ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCACACTTGAGAGAGAGTGA
JMSF004O05+ ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCACACTTGAGAGAGAGTGA
JMFF003I15+ ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCACACTTGAGAGAGAGTGA
                      ____________________________________________________________
consensus ACTGCTGGAGATGCCATTGTAGATCGAGAAACTTCTGATCTCACACTTGAGAGAGAGTGA
 
. : . : . : . : . : . :
JMSF046E06+ TAGTGGAAAAATGAGGCAGAAGTGCAAAACCC
JMSF045G01+ TAGTGGAAAAATGAGGCAGAAGTGCAAAACCC
JMSF004O05+ TAGTGGAAAAATGAGGCAGAAGTGCAAAACCC
JMFF003I15+ TAGTGGAAAAATGAGGCAGAAGTGCAAAACCCTAGCACTGAGAAAAGTCGAAAACAATCT
                      ____________________________________________________________
consensus TAGTGGAAAAATGAGGCAGAAGTGCAAAACCCTAGCACTGAGAAAAGTCGAAAACAATCT