Previous Contig 000145:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I07Sequence554000145 (40)pir|S17917|S179173e-57ADP,ATP carrier protein precursor - potato773000145 (40)sp|P27081|ADT2_SOLTU1e-87ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF005E19Sequence474000145 (40)pir|S17917|S179175e-42ADP,ATP carrier protein precursor - potato778000145 (40)sp|P27081|ADT2_SOLTU3e-87ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF007O15Sequence556000145 (40)pir|S17917|S179173e-58ADP,ATP carrier protein precursor - potato778000145 (40)sp|P27081|ADT2_SOLTU9e-89ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF008B20Sequence548000145 (40)pir|S17917|S179173e-56ADP,ATP carrier protein precursor - potato661000145 (40)pir|S17917|S179174e-69ADP,ATP carrier protein precursor - potato
JMFF009O03Sequence528000145 (40)pir|S17917|S179174e-54ADP,ATP carrier protein precursor - potato710000145 (40)sp|P27081|ADT2_SOLTU3e-78ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF022A06Sequence465000145 (40)pir|S17917|S179179e-42ADP,ATP carrier protein precursor - potato766000145 (40)sp|P27081|ADT2_SOLTU1e-78ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF025G09Sequence557000145 (40)pir|S17917|S179173e-58ADP,ATP carrier protein precursor - potato810000145 (40)sp|P27081|ADT2_SOLTU1e-90ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF026G24Sequence506000145 (40)pir|S17917|S179178e-49ADP,ATP carrier protein precursor - potato748000145 (40)sp|P27081|ADT2_SOLTU2e-86ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF028D08Sequence548000145 (40)pir|S17917|S179173e-56ADP,ATP carrier protein precursor - potato766000145 (40)sp|P27081|ADT2_SOLTU4e-88ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF029G06Sequence453000145 (40)gb:LEU89839_16847963e-25Lycopersicon esculentum ADP/ATP translocator mRNA, complete cds.
JMFF034H14Sequence767000145 (40)sp|P27081|ADT2_SOLTU3e-87ADP,ATP carrier protein, mitochondrial precursor (ADP/ATP translocase) (Adenine
JMFF040J07Sequence643000145 (40)pir|S17917|S179171e-65ADP,ATP carrier protein precursor - potato
JMFF041E19Sequence644000145 (40)pir|S17917|S179173e-78ADP,ATP carrier protein precursor - potato423000145 (40)gb:LEU89839_16847964e-21Lycopersicon esculentum ADP/ATP translocator mRNA, complete cds.
JMFF043P05Sequence644000145 (40)pir|S17917|S179171e-69ADP,ATP carrier protein precursor - potato414000145 (40)gb:LEU89839_16847968e-17Lycopersicon esculentum ADP/ATP translocator mRNA, complete cds.
JMFF044K14Sequence636000145 (40)pir|S17917|S179174e-77ADP,ATP carrier protein precursor - potato427000145 (40)pir|S17917|S179174e-26ADP,ATP carrier protein precursor - potato
JMFF045L20Sequence612000145 (40)pir|S17917|S179177e-68ADP,ATP carrier protein precursor - potato484000145 (40)pir|S17917|S179172e-29ADP,ATP carrier protein precursor - potato
JMFF046B04Sequence475000145 (40)pir|S17917|S179171e-42ADP,ATP carrier protein precursor - potato440000145 (40)gb:LEU89839_16847961e-12Lycopersicon esculentum ADP/ATP translocator mRNA, complete cds.
JMFF050A05Sequence644000145 (40)pir|S17917|S179174e-73ADP,ATP carrier protein precursor - potato622000145 (40)pir|S17917|S179171e-51ADP,ATP carrier protein precursor - potato
JMFN003J17Sequence616000145 (40)pir|S17917|S179179e-66ADP,ATP carrier protein precursor - potato
JMFN005K13Sequence627000145 (40)pir|S17917|S179174e-92ADP,ATP carrier protein precursor - potato
JMFN006F21Sequence622000145 (40)pir|S17917|S179173e-76ADP,ATP carrier protein precursor - potato
JMFN011D17Sequence590000145 (40)pir|S17917|S179172e-53ADP,ATP carrier protein precursor - potato
JMFN013K22Sequence618000145 (40)pir|S17917|S179174e-66ADP,ATP carrier protein precursor - potato
JMFN036H02Sequence492000145 (40)gb:ATAT_15440902e-76A.thaliana ANT1 mRNA for adenylate translocator.
JMFS159H09Sequence441000145 (40)pir|S17917|S179173e-46ADP,ATP carrier protein precursor - potato

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046B04- CCTTATGGCGGATCAACCTGGAGAGTTTT
rJMFF050A05- CCTTATGGCGGATCACCCTGGAGAGTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTT
 
. : . : . : . : . : . :
rJMFF046B04- TTTTTTTTTTTTAGCTAAAATCAACCATCATAAAATAGAAACCAAATTCGATAATTATGT
rJMFF041E19- TAGAAACCAAATTCGATAATTATGT
rJMFF043P05- AAACCAAATTCGATAATTATGT
rJMFF050A05- TTTTTTTTTTT------------------------TAGAAACCAAATTCGATAATTATGT
JMFN011D17+ AGAAACCAAATTCGATAATTATGT
rJMFF008B20- ATTCGATAATTATGT
rJMFF029G06- ATTCGATAATTATGT
rJMFF044K14- TATGT
rJMFF003I07- AATTCGATAATTATGT
rJMFF034H14- ATTATGT
rJMFF005E19- CAAATTCGATAATTATGT
rJMFF028D08- ATTATGT
rJMFF009O03- TTATGT
rJMFF007O15- AATTCGATAATTATGT
rJMFF025G09- TATGT
                      ____________________________________________________________
consensus TTTTTTTTTTTTAGCTAAAATCAACCATCATAAAATAGAAACCAAATTCGATAATTATGT
 
. : . : . : . : . : . :
rJMFF046B04- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF041E19- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF043P05- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF050A05- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
JMFN011D17+ GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF008B20- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
JMFN013K22+ TCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
JMFN003J17+ CTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF040J07- TGCAAAAACAAAGCACCCTCTANAGGAGGGGTGCGTTCA
rJMFF029G06- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF044K14- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF003I07- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF034H14- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF005E19- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF028D08- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF026G24- CCTTTCTC-AGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF009O03- GAACTCTCCCTTTCTC-AGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF007O15- GAACTCTCCCTTTCTC-AGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF022A06- CCTTTCTC-AGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
rJMFF025G09- GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
                      ____________________________________________________________
consensus GAACTCTCCCTTTCTCAAGTCTGCAAAAACAAAGCACCCTCTAAAGGAGGGGTGCGTTCA
 
. : . : . : . : . : . :
rJMFF046B04- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF041E19- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF043P05- TGTTTGGGTACAACCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTACCCTG
rJMFF050A05- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
JMFN011D17+ TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF008B20- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
JMFN013K22+ TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
JMFN003J17+ TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF040J07- TGTNTGGGNANAAGCCNCAATAGAAAATNAANTTATTCCAAAGCCAAAAACATTATCCTG
rJMFF029G06- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF044K14- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF003I07- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF034H14- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF005E19- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF028D08- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF026G24- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF009O03- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF007O15- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF022A06- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
rJMFF025G09- TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
                      ____________________________________________________________
consensus TGTTTGGGTACAAGCCCCAATAAAAAATCAAATTATTCCAAAGCCAAAAACATTAGCCTG
 
. : . : . : . : . : . :
rJMFF046B04- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF041E19- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF043P05- AGTGAATTCTTGAATCAAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF050A05- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
JMFN011D17+ AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF008B20- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
JMFN013K22+ AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
JMFN003J17+ AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF040J07- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF029G06- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF044K14- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF003I07- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF034H14- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF005E19- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF028D08- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF026G24- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF009O03- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF007O15- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF022A06- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
rJMFF025G09- AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
                      ____________________________________________________________
consensus AGTGAATTCTTGAATCGAAACTCGGTTTTTCATCACCATCTAACACTGCTAAAAGCAATA
 
. : . : . : . : . : . :
rJMFF046B04- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF041E19- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTTTTTCCCAAAACAAG
rJMFF043P05- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAAAACCATACTTCTTTCCCAAAACAAG
rJMFF050A05- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
JMFN011D17+ TGTGAGGGGGGTCTCTGGACCTTAAGTCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF008B20- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
JMFN013K22+ TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF045L20- CTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
JMFN003J17+ TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF040J07- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF029G06- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF044K14- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF003I07- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF034H14- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF005E19- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF028D08- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF026G24- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF009O03- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF007O15- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF022A06- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
rJMFF025G09- TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
                      ____________________________________________________________
consensus TGTGAGGGGGGTCTCTGGACCTTAAGCCCCACCAGAACCATACTTCTTTCCCAAAACAAG
 
. : . : . : . : . : . :
rJMFF046B04- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF041E19- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF043P05- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAAATGTT
rJMFF050A05- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
JMFN011D17+ CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF008B20- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
JMFN013K22+ CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF045L20- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
JMFN003J17+ CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF040J07- CACCTGAANCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF029G06- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF044K14- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF003I07- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF034H14- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF005E19- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF028D08- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF026G24- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF009O03- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF007O15- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF022A06- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
rJMFF025G09- CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
                      ____________________________________________________________
consensus CACCTGAAGCTTGTCGTACCCAGCCAACACACCAGCACCAGCAACGGCACGCAAGATGTT
 
. : . : . : . : . : . :
rJMFF046B04- GGCACCAGCACCCTTAAACAGAGATTTANGACCTTCATTCTTGAGGATCTG
rJMFF041E19- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF043P05- GGCACCAGCACCCTTAAACAAAAATTTAGGACCTTCATTCTTGAGGATCTGAAAAAATGC
rJMFF050A05- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
JMFN011D17+ GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF008B20- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
JMFN013K22+ GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF045L20- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
JMFN003J17+ GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF040J07- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF029G06- GGCACCANCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF044K14- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF003I07- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF034H14- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF005E19- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF028D08- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF026G24- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF009O03- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF007O15- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF022A06- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
rJMFF025G09- GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
                      ____________________________________________________________
consensus GGCACCAGCACCCTTAAACAGAGATTTAGGACCTTCATTCTTGAGGATCTGAGAGAATGC
 
. : . : . : . : . : . :
rJMFF041E19- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA
rJMFF043P05- ATCAAAAGAGCTCTTATACTTG
rJMFF050A05- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
JMFN011D17+ ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF008B20- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
JMFN013K22+ ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF045L20- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
JMFN003J17+ ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF040J07- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCACCATGTCATCATCATTCTTCTAC-GG
rJMFF029G06- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTACGGG
rJMFF044K14- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF003I07- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF034H14- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF005E19- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF028D08- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF026G24- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF009O03- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF007O15- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF022A06- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
rJMFF025G09- ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
                      ____________________________________________________________
consensus ATCAAAAGAGCTCTTATACTTGACAGCTTCACCA-GATGTCATCATCATTCTTCTAC-GG
 
. : . : . : . : . : . :
rJMFF050A05- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
JMFN011D17+ ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF008B20- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
JMFN013K22+ ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF045L20- ACTGTGTCAATTGGGTA
JMFN003J17+ ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF040J07- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF029G06- ACTGTGTCAATTGGGTA
rJMFF044K14- ACTG
rJMFF003I07- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF034H14- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF005E19- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF028D08- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF026G24- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF009O03- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF007O15- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF022A06- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
rJMFF025G09- ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
                      ____________________________________________________________
consensus ACTGTGTCAATTGGGTAAGAAGCAAGACCAGCACCGTTTGTAATGAGCCAACCAAGAGCA
 
. : . : . : . : . : . :
rJMFF050A05- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
JMFN011D17+ AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF008B20- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
JMFN013K22+ AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
JMFN003J17+ AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF040J07- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF003I07- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF034H14- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF005E19- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF028D08- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF026G24- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF009O03- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF007O15- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF022A06- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
rJMFF025G09- AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
JMFN036H02+ CTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
                      ____________________________________________________________
consensus AAGCTAGCAAAGAAACTATCCTGTAAGTTTCCAGTCAAGACAACTGGCTTAATAGAGTCA
 
. : . : . : . : . : . :
rJMFF050A05- TATAATCCAAAGTACAGCC
JMFN011D17+ TATAATCCAAAGTACAGCCCACGATAGA
rJMFF008B20- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
JMFN013K22+ TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
JMFN003J17+ TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF040J07- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF003I07- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF034H14- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF005E19- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF028D08- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF026G24- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF009O03- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF007O15- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF022A06- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
rJMFF025G09- TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
JMFN036H02+ TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
                      ____________________________________________________________
consensus TATAATCCAAAGTACAGCCCACGATAGACAATAATTCCAACACAGGAGATATTGAATCCA
 
. : . : . : . : . : . :
rJMFF008B20- CGGTAAAGTCCTGCAATACCATCAGANGCAAGAGTCTTCCTGTAGACG
JMFN013K22+ CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAG
JMFN003J17+ CGGTAAAGTCCTGCAATACCATCAGAGGCAA
rJMFF040J07- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF003I07- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF034H14- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF005E19- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF028D08- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF026G24- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF009O03- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF007O15- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF022A06- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
rJMFF025G09- CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
JMFN036H02+ CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
                      ____________________________________________________________
consensus CGGTAAAGTCCTGCAATACCATCAGAGGCAAGAGTCTTCCTGTAGACGTCAATCAAACCA
 
. : . : . : . : . : . :
rJMFF040J07- TTG
rJMFF003I07- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF034H14- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF005E19- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF028D08- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF026G24- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF009O03- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATT
rJMFF007O15- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
rJMFF022A06- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAGCCCAAACGTGN
rJMFF025G09- TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
JMFN036H02+ TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
                      ____________________________________________________________
consensus TTGAACTGCCTTCCACTTCCTCCCTTCTTTGCAGCCTTGGCATCATTAG-CCAAACGTGT
 
. : . : . : . : . : . :
rJMFF003I07- TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAA
rJMFF034H14- TCGAGCATAGTCCAATGAGTAGAC-NAAAAGTAATGATGAAGCA
rJMFF005E19- TCGAGCATAGTCCAATGAGTAGAC-NAAAAGTAATGATGAAGCA
rJMFF028D08- TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAAGC
rJMFF026G24- TCGAGCATAGTCCAATGAGTAGAC-NAAAAGTAATGAT
rJMFF007O15- TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAAGCACC
rJMFF022A06- TCGAGCATAGTCCAATGAGTAGACNAAAAAGTAATGATGAAGCACCAGCAGCAC
rJMFF025G09- TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAAGCACCAGCAGCACCACCTG
JMFN036H02+ TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAAGCACCAGCAGCACCACCTG
                      ____________________________________________________________
consensus TCGAGCATAGTCCAATGAGTAGAC-AAAAAGTAATGATGAAGCACCAGCAGCACCACCTG
 
. : . : . : . : . : . :
rJMFF025G09- AAGCAAGGTTGCCAGCAAACCATTTCCAG
JMFN036H02+ AAGCAAGGTTGCCAGCAAACCATTTCCAGTAGCCATCACGGTCCTTCTTGAAGTTGAAGA
JMFN005K13+ GCAAGGTTGCCAGCAAACCATTTCCAGTAGCCATCACGGTCCTTCTTGAAGTTGAAGA
                      ____________________________________________________________
consensus AAGCAAGGTTGCCAGCAAACCATTTCCAGTAGCCATCACGGTCCTTCTTGAAGTTGAAGA
 
. : . : . : . : . : . :
JMFN036H02+ GCCTCTTAAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAACTAACGAATAA
JMFN005K13+ GCCTCTTAAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
JMFF044K14+ AAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
JMFN006F21+ TAAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
JMFF041E19+ TAAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
JMFF050A05+ TGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
JMFF045L20+ GGGAAGTAACGAATAA
JMFF043P05+ TGAATGCAAAGTTCAAGGCNTGAGT-GGGAAGTAACGAATAA
                      ____________________________________________________________
consensus GCCTCTTAAAGTAATCCTTGAATGCAAAGTTCAAGGCCTGAGTGGGGAAGTAACGAATAA
 
. : . : . : . : . : . :
JMFN036H02+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFN005K13+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF044K14+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFN006F21+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF041E19+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF050A05+ CATGNGCAGTATNTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF045L20+ CATGGCCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF043P05+ CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
JMFF025G09+ CCTTGATGGTTCGACTGA
JMFF007O15+ CTTGATGGTTCGACTGA
JMFF028D08+ TTCGACTGA
JMFF008B20+ TTCGACTGA
JMFF009O03+ GGTTCGACTGA
JMFF003I07+ TGATGGTTCGACTGA
                      ____________________________________________________________
consensus CATTGGCAGTATTTCCTCTCCACAGTGAACCAATTCCTTCATCCTTGATGGTTCGACTGA
 
. : . : . : . : . : . :
JMFN036H02+ AACAGT-CACCAATACCCTT-TAAGGTTCAGAGAGC
JMFN005K13+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF044K14+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFN006F21+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF041E19+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF050A05+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF045L20+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF043P05+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF025G09+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF007O15+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF028D08+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF008B20+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF009O03+ AACAGTCCACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFF026G24+ GGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
JMFS159H09+ CCTTAATCATCTCATCT
JMFF003I07+ AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
                      ____________________________________________________________
consensus AACAGT-CACCAATACCCTTGTAAGGTTCAGAGAGCCTACCAGCCTTAATCATCTCATCT
 
. : . : . : . : . : . :
JMFN005K13+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF044K14+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFN006F21+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF041E19+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF050A05+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF045L20+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF043P05+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF025G09+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF007O15+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF028D08+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF008B20+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF009O03+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF022A06+ TTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF026G24+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF005E19+ TGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF046B04+ TTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTNGAGACAGCT
JMFS159H09+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
JMFF003I07+ TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
                      ____________________________________________________________
consensus TGGTTTTGAATCAAGAGTTTTACACGCTCAATAGGGGCAGCTGCAGTCTTTGAGACAGCT
 
. : . : . : . : . : . :
JMFN005K13+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF044K14+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFN006F21+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGAA
JMFF041E19+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF050A05+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF045L20+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF043P05+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF025G09+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF007O15+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF028D08+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF008B20+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF009O03+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF022A06+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF026G24+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF005E19+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF046B04+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFS159H09+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
JMFF003I07+ GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
                      ____________________________________________________________
consensus GCTGAAACACCACCCATGAGAAAGTCAATTGCAAAACTTGTAAATCCTTTCTCTGCCGGA
 
. : . : . : . : . : . :
JMFN005K13+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF044K14+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFN006F21+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF041E19+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF050A05+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF045L20+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF043P05+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF025G09+ GCTTGCACAAAGACTGGTGAAGCATTTGAAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF007O15+ GCTTGCACAAAGACTGGTGAAGCATTTGAAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF028D08+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF008B20+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF009O03+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF022A06+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF026G24+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF005E19+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF046B04+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFS159H09+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
JMFF003I07+ GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
                      ____________________________________________________________
consensus GCTTGCACAAAGACTGGTGAAGCATTTGCAGTAATTGATGACAGATCCATGGTGGCTTGA
 
. : . : . : . : . : . :
JMFN005K13+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF044K14+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFN006F21+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF041E19+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF050A05+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF045L20+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF043P05+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF025G09+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF007O15+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF028D08+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF008B20+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF009O03+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF022A06+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF026G24+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF005E19+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF046B04+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFS159H09+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
JMFF003I07+ CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
                      ____________________________________________________________
consensus CATTGTTGTGTGACAGGATATTTCAACCCAGCATTGCTGTAGTTTCCACAAGCAAAATGC
 
. : . : . : . : . : . :
JMFN005K13+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF044K14+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFN006F21+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF041E19+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF050A05+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF045L20+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF043P05+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF025G09+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF007O15+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF028D08+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF008B20+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF009O03+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF022A06+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCGATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF026G24+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCGATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF005E19+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF046B04+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFS159H09+ CTACAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
JMFF003I07+ CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
                      ____________________________________________________________
consensus CTAGAGTACTGAGTAGGCCTTGGTAAACCCCCATAGCGAGCTTGGGCATCTTGGTAAAGA
 
. : . : . : . : . : . :
JMFN005K13+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF044K14+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFN006F21+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF041E19+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF050A05+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF045L20+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF043P05+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF025G09+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF007O15+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF028D08+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF008B20+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF009O03+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF022A06+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF026G24+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF005E19+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF046B04+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFS159H09+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
JMFF003I07+ CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
                      ____________________________________________________________
consensus CTTGAGCTCAGATGAAGCTGGTTAGCTGCCTTCTGGAAAACAGTGGGGTGCTGTGGCATA
 
. : . : . : . : . : . :
JMFN005K13+ TCTGCCATTGTTTTCTATAACAATCTC
JMFF044K14+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFN006F21+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF041E19+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF050A05+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF045L20+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF043P05+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF025G09+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF007O15+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF028D08+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF008B20+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF009O03+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF022A06+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF026G24+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF005E19+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFF046B04+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
JMFS159H09+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCCACTCGCCTGGAACGGCGCCTCAGG
JMFF003I07+ TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
                      ____________________________________________________________
consensus TCTGCCATTGTTTTCTATAACAATCTCCTGCGCTCAACTCGCCTGGAACGGCGCCTCAGG
 
. : . : . : . : . : . :
JMFF044K14+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTT
JMFN006F21+ AAGAGATCGAGTAATGGAGGAGAGAAGAA
JMFF041E19+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGT
JMFF050A05+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGG
JMFF045L20+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGG
JMFF043P05+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGG
JMFF025G09+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
JMFF007O15+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
JMFF028D08+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
JMFF008B20+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
JMFF009O03+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGT
JMFF022A06+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGA
JMFF026G24+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAG
JMFF005E19+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
JMFF046B04+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGG
JMFS159H09+ AAGA
JMFF003I07+ AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG
                      ____________________________________________________________
consensus AAGAGATCGAGTAATGGAGGAGAGAAGAACGAGGAGTGTTCGGTAGAGAGGAAATGGGAG