Previous Contig 000133:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003E01Sequence537000133 (3)sp|P33490|ABP1_TOBAC8e-69Auxin-binding protein T85 precursor (ABP).>pir|S31835|S31835 auxin-binding prote
JMFF003I03Sequence566000133 (3)sp|P33490|ABP1_TOBAC6e-79Auxin-binding protein T85 precursor (ABP).>pir|S31835|S31835 auxin-binding prote679000133 (3)sp|P33491|ABP2_TOBAC2e-79Auxin-binding protein T92 precursor (ABP).>pir|S31837|S31837 auxin-binding prote

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003I03- ANGAGTATAGCATGAAATGCCCAAATTATCTGATGTACATATTGTGATTAACTA
                      ____________________________________________________________
consensus ANGAGTATAGCATGAAATGCCCAAATTATCTGATGTACATATTGTGATTAACTA
 
. : . : . : . : . : . :
rJMFF003I03- TTTCTATCACCTCCAAGGAAAACACTTGGATGTTCAGTGGTAACAAAATACAAAAATTCA
                      ____________________________________________________________
consensus TTTCTATCACCTCCAAGGAAAACACTTGGATGTTCAGTGGTAACAAAATACAAAAATTCA
 
. : . : . : . : . : . :
rJMFF003I03- TGCAAATCTTACACTTGTTTCATTGGCTTCTTTCTGGCAGCATCTTTAGTTGAANAAGTT
                      ____________________________________________________________
consensus TGCAAATCTTACACTTGTTTCATTGGCTTCTTTCTGGCAGCATCTTTAGTTGAANAAGTT
 
. : . : . : . : . : . :
rJMFF003I03- AAAGTTCATCGTTTACTGTAGTCTGATGGCACTCCTCATCCCAATAATAAGGGTACTTCA
JMFF003I03+ CTCATCCCAATAATAAGGGTACTTCA
                      ____________________________________________________________
consensus AAAGTTCATCGTTTACTGTAGTCTGATGGCACTCCTCATCCCAATAATAAGGGTACTTCA
 
. : . : . : . : . : . :
rJMFF003I03- GTCTAGCAGCCGTGTGTGGCATGAGCCAGTCGTCATATATGAACACTTTCACTGGTGGGC
JMFF003I03+ GTCTAGCAGCCGTGTGTGGCATGAGCCAGTCGTCATATATGAACACTTTCACTGGTGGGC
JMFF003E01+ TAGCAGCCGTGNGTGGCATGAGCCAGTNGTCATATATGAACACTTTCAGTGGTGGGC
                      ____________________________________________________________
consensus GTCTAGCAGCCGTGTGTGGCATGAGCCAGTCGTCATATATGAACACTTTCACTGGTGGGC
 
. : . : . : . : . : . :
rJMFF003I03- GAGATATAATAACCAANACTTGTAAATCCTCTGATTCACCAGTGTTCCATACCTGATGAG
JMFF003I03+ GAGATATAATAACCAAGACTTGTAAATCCTCTGATTCACCAGTGTTCCATACCTGATGAG
JMFF003E01+ GAGATATAATAACCAAGACTTGTAAATCCTNTGATTCACCAGTGTTCCATACCTGATGAG
                      ____________________________________________________________
consensus GAGATATAATAACCAAGACTTGTAAATCCTCTGATTCACCAGTGTTCCATACCTGATGAG
 
. : . : . : . : . : . :
rJMFF003I03- CATCATTAGTAGGTATATGAAAAGTGCTATTTGTGAANATAGGCAATTCCTGCGGGTTCC
JMFF003I03+ CATCATTAGTAGGTATATGAAAAGTGCTATTTGTGAAGATAGGCAATTCCTGCGGGTTCC
JMFF003E01+ CATCATTAGTAGGTATATGAAAAGTGCTATTTGTGAAGATAGGCAATTCNTGCGGGTTCC
                      ____________________________________________________________
consensus CATCATTAGTAGGTATATGAAAAGTGCTATTTGTGAAGATAGGCAATTCCTGCGGGTTCC
 
. : . : . : . : . : . :
rJMFF003I03- CAGGGTATTTTGGATGTGAGTTANATGCAAGGTANAGGGTACCACTCCCCTTCAGCACAA
JMFF003I03+ CAGGGTATTTTGGATGTGAGTTAGATGCAAGGTAGAGGGTACCACTCCCCTTCAGCACAA
JMFF003E01+ CAGGGTATTTTGGATGTGAGTTAGATGCAAGGTAGAGGGTACCACTCCCCTTCAGCACAA
                      ____________________________________________________________
consensus CAGGGTATTTTGGATGTGAGTTAGATGCAAGGTAGAGGGTACCACTCCCCTTCAGCACAA
 
. : . : . : . : . : . :
rJMFF003I03- CAAANACTTCCTCACAANAGTGTCTATGAATTGGTGTTTTAAAACCTGGGGCAAATGTTT
JMFF003I03+ CAAAGACTTCCTCACAAGAGTGTCTATGAATTGGTGTTTTAGAACCTGGGGCAAATGTTT
JMFF003E01+ CAAAGACTTCCTCACAAGAGTGTCTATGAATTGGTGTTTTAGAACCTGGGGCAAATGTTT
                      ____________________________________________________________
consensus CAAAGACTTCCTCACAAGAGTGTCTATGAATTGGTGTTTTAGAACCTGGGGCAAATGTTT
 
. : . : . : . : . : . :
rJMFF003I03- GGAGCCATACCTCTACCTCTTTCATGCCATGCATGACTGAACCTGCAAGCGTGATATGAG
JMFF003I03+ GGAGCCATACCTCTACCTCTTTCATGCCATGCATGACTGAACCTGCAAGCGTGATATGAG
JMFF003E01+ GGAGCCATACCTCTACCTCTTTCATGCCATGCATGACTGAACCTGCAAGCGTGATATGAG
                      ____________________________________________________________
consensus GGAGCCATACCTCTACCTCTTTCATGCCATGCATGACTGAACCTGCAAGCGTGATATGAG
 
. : . : . : . : . : . :
rJMFF003I03- ATAAACCAGGCCTTCCATAGTTATCTTGTGGAAGCTCACTGATATTCCTAATTAGCGGTA
JMFF003I03+ ATAAACCAGGCCTTCCATAGTTATCTTGTGGAAGCTCACTGATATTCCTAATTAGCGGTA
JMFF003E01+ ATAAACCAGGCCTTCCATAGTTATCTTGTGGAAGCTCACTGATATTCCTAATTAGCGGTA
                      ____________________________________________________________
consensus ATAAACCAGGCCTTCCATAGTTATCTTGTGGAAGCTCACTGATATTCCTAATTAGCGGTA
 
. : . : . : . : . : . :
rJMFF003I03- ATCCTTTGATTGAACAGTCCGAAGC
JMFF003I03+ ATCCTTTGATTGAACAGTCCGAAGCTCCGGCGGTCGAGGAGAAGAAAACAACCGCCAAAG
JMFF003E01+ ATCCTTTGATTGAACAGTCCGAAGCTCCGGCGGTCGAGGAGAAGAAAACAACCGCCAAAG
                      ____________________________________________________________
consensus ATCCTTTGATTGAACAGTCCGAAGCTCCGGCGGTCGAGGAGAAGAAAACAACCGCCAAAG
 
. : . : . : . : . : . :
JMFF003I03+ ACAAAACTCCGACTAAACGCCGGCTCATTTTCACAAAATTCTCCGGCCTCCCTCTC
JMFF003E01+ ACAAAACTCCGACTAAACGCCGGCTCATTTTCACAAAATTCTCCGGCCTCCCTCTCCGAC
                      ____________________________________________________________
consensus ACAAAACTCCGACTAAACGCCGGCTCATTTTCACAAAATTCTCCGGCCTCCCTCTCCGAC