Previous Contig 000131:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003D10Sequence292000131 (3)
JMSF030L10Sequence261000131 (3)
JMSF050A23Sequence660000131 (3)gb:AB006697_15098366e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY099856_1576745024404gb:OSJN00292_1698071e-110Oryza sativa genomic DNA, chromosome 4, BAC clone: P0076O17, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050A23+ ATNTGATTCATCTTTAGAATCTTCAGTGTTTCCTAA
                      ____________________________________________________________
consensus ATNTGATTCATCTTTAGAATCTTCAGTGTTTCCTAA
 
. : . : . : . : . : . :
JMSF050A23+ CAAACTNTTCTTNTTATCTGCTTTTGACTTGGGCAAATATGTAACAACAGGATGTGTTCT
                      ____________________________________________________________
consensus CAAACTNTTCTTNTTATCTGCTTTTGACTTGGGCAAATATGTAACAACAGGATGTGTTCT
 
. : . : . : . : . : . :
JMSF050A23+ TCCAAATGCTGCCAACGGCTGGTACTCTGGATCACTGGGATCTGGAGGATATCCAGAGCG
                      ____________________________________________________________
consensus TCCAAATGCTGCCAACGGCTGGTACTCTGGATCACTGGGATCTGGAGGATATCCAGAGCG
 
. : . : . : . : . : . :
JMSF050A23+ AGCAAAGAAAACATGAGCATAGAGACTGCCATTGTGCTTCAAAGCCTCAGATGGAAAATA
                      ____________________________________________________________
consensus AGCAAAGAAAACATGAGCATAGAGACTGCCATTGTGCTTCAAAGCCTCAGATGGAAAATA
 
. : . : . : . : . : . :
JMSF050A23+ CTTCAAAGAAAGTGACCTTGAGCTTTCATGTCCCCAAACAGCATAAGGTATATTTGTCTC
                      ____________________________________________________________
consensus CTTCAAAGAAAGTGACCTTGAGCTTTCATGTCCCCAAACAGCATAAGGTATATTTGTCTC
 
. : . : . : . : . : . :
JMSF050A23+ ATGCCAAAAGAGCGCAGTTTCACTCCCAAAGTCATTGAACTTCTCTTGTTCAGAGAGATA
                      ____________________________________________________________
consensus ATGCCAAAAGAGCGCAGTTTCACTCCCAAAGTCATTGAACTTCTCTTGTTCAGAGAGATA
 
. : . : . : . : . : . :
JMSF050A23+ CAACCACATGTCCAAGGGTTCGCCTTTGTGGAAGAGATTGGAGATCTGGACAGAAGGATC
                      ____________________________________________________________
consensus CAACCACATGTCCAAGGGTTCGCCTTTGTGGAAGAGATTGGAGATCTGGACAGAAGGATC
 
. : . : . : . : . : . :
JMSF050A23+ GGAAGGGGCGCGTTTGGGGGAGAAGAACTTTGATGCGAAGTACCAGAATATAGCCATTCT
                      ____________________________________________________________
consensus GGAAGGGGCGCGTTTGGGGGAGAAGAACTTTGATGCGAAGTACCAGAATATAGCCATTCT
 
. : . : . : . : . : . :
JMSF050A23+ AATTACCCCCGTCAACATCTGCCCCATCCCCGGCTGCTGTTGTTGCTGCTGCCTTCCTCC
JMSF030L10+ GCCTTCCTCC
                      ____________________________________________________________
consensus AATTACCCCCGTCAACATCTGCCCCATCCCCGGCTGCTGTTGTTGCTGCTGCCTTCCTCC
 
. : . : . : . : . : . :
JMSF050A23+ TCCTCCTCCTCCTCCTCCACCACCGTCGCCTCCATCTCCGGCAACTGGCGGCGCCATCCT
JMSF030L10+ TCCTCCTCCTCCTCCTCCACCACCGTCGCCTCCATCTCCGGCAACTGGCGGCGCCATCCT
                      ____________________________________________________________
consensus TCCTCCTCCTCCTCCTCCACCACCGTCGCCTCCATCTCCGGCAACTGGCGGCGCCATCCT
 
. : . : . : . : . : . :
JMSF050A23+ CTCGACTACTAACTCCGAAGCCTTATCACTACCGTTTGCGCGCGTCCAAAGTCGGAAAAG
JMSF030L10+ CTCGACTACTAACTCCGAAGCCTTATCANTACCGTTTGCGCGCGTCCAAAGTCGGAAAAG
JMFF003D10+ CTAACTCCGAAGCCTTATCNCTNCCGTTTGCGNGCGTCCAAAGTNGGAAAAG
                      ____________________________________________________________
consensus CTCGACTACTAACTCCGAAGCCTTATCACTACCGTTTGCGCGCGTCCAAAGTCGGAAAAG
 
. : . : . : . : . : . :
JMSF050A23+ CAAGTGCAAATCGGCGAACTT
JMSF030L10+ CAAGTGCAAATCGGCGAACTTCGATGTATACTAGAACGAAAAAGATAGTTAAAGGCTTAA
JMFF003D10+ CAAGNGCAAATCGGNGAACTTNGATGTATNCTAGAACGAAAAAGATAGTTAAAGGCTTAA
                      ____________________________________________________________
consensus CAAGTGCAAATCGGCGAACTTCGATGTATACTAGAACGAAAAAGATAGTTAAAGGCTTAA
 
. : . : . : . : . : . :
JMSF030L10+ AGCACCAGTGGTATACTTGTATTGGGAATCATTAGAGCGGTGGACACGCGAGTTTGCAAC
JMFF003D10+ AGCCCCNGTGGTATACTTGTATTGGGAATCNTTAGAGCGGNGGNCNCGCGAGTTTGCAAC
                      ____________________________________________________________
consensus AGCCCCAGTGGTATACTTGTATTGGGAATCATTAGAGCGGTGGACACGCGAGTTTGCAAC
 
. : . : . : . : . : . :
JMSF030L10+ TAGAACAAAT
JMFF003D10+ TAGAACAAATGGNCAANGNCTGCCAGATATTTTCCCCAAGTTTGTATTTNTGCCCTAATT
                      ____________________________________________________________
consensus TAGAACAAATGGNCAANGNCTGCCAGATATTTTCCCCAAGTTTGTATTTNTGCCCTAATT
 
. : . : . : . : . : . :
JMFF003D10+ TTTTTGAAAAAAAAAAATAAAATCTGATCATCTTTGTTGAGATTTTTTTTCTATCTTAGT
                      ____________________________________________________________
consensus TTTTTGAAAAAAAAAAATAAAATCTGATCATCTTTGTTGAGATTTTTTTTCTATCTTAGT