Previous Contig 000124:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B07Sequence329000124 (4)gb:AF499720_18061434e-09Thellungiella halophila putative RING zinc finger protein-like protein mRNA, com583000124 (4)gb:AF499720_18061433e-28Thellungiella halophila putative RING zinc finger protein-like protein mRNA, com
JMFN031H20Sequence566000124 (4)gb:AF499720_18061433e-37Thellungiella halophila putative RING zinc finger protein-like protein mRNA, com
JMFN036F12Sequence512000124 (4)gb:AF499720_18061432e-35Thellungiella halophila putative RING zinc finger protein-like protein mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003B07- TAGTACATATCCGGCAATGTATAGAGTTCT
                      ____________________________________________________________
consensus TAGTACATATCCGGCAATGTATAGAGTTCT
 
. : . : . : . : . : . :
rJMFF003B07- GGTCACAAGAGACCCGTCACTGTGAAAGGACGCAAACATCGCCANAAAACACAAGTACAC
                      ____________________________________________________________
consensus GGTCACAAGAGACCCGTCACTGTGAAAGGACGCAAACATCGCCANAAAACACAAGTACAC
 
. : . : . : . : . : . :
rJMFF003B07- AAGCTACTAAAAACACTCAGCCTGTACACTACCACGCTGTGCTCTATACNTACAAACTCC
JMFN036F12+ TACAAACTCC
                      ____________________________________________________________
consensus AAGCTACTAAAAACACTCAGCCTGTACACTACCACGCTGTGCTCTATACNTACAAACTCC
 
. : . : . : . : . : . :
rJMFF003B07- CANAAACATCGTACACAGCCACAAAAAAAAACACTCACNTCGGAGCANNGTCACCATCCT
JMFN036F12+ CACAAACATCGTACACAGCCACAAAAAAAAACACTCACATCGGAGCAGTGTCACCATCCT
                      ____________________________________________________________
consensus CACAAACATCGTACACAGCCACAAAAAAAAACACTCACATCGGAGCAGTGTCACCATCCT
 
. : . : . : . : . : . :
rJMFF003B07- CGTCCANAGGCATAATGTAATTCCGGCAGAGGGGGCACGTAACATTCCAATACTTGAGCC
JMFN036F12+ CGTCCAGAGGCATAATGTAATTCCGGCAGAGGGGGCACGTAACATTCCAATACTTGAGCC
JMFN031H20+ AGGCATAATGTAATTCCGGCAGAGGGGGCACGTAACATTCCAATACTTGAGCC
                      ____________________________________________________________
consensus CGTCCAGAGGCATAATGTAATTCCGGCAGAGGGGGCACGTAACATTCCAATACTTGAGCC
 
. : . : . : . : . : . :
rJMFF003B07- ATTTCTCGAGACACATCGCGTGGAAAACATGCCCGCAAGACAACTGGTTTACCATTGCAT
JMFN036F12+ ATTTCTCGAGACACATGGCGTGGAAAACATGCCCGCAAGACAACTGGTTTACCATTGCAT
JMFN031H20+ ATTTCTCGAGACACATCGCGTGGAAAACATGCCCGCAAGACAACTGGTTTACCATTGCAT
                      ____________________________________________________________
consensus ATTTCTCGAGACACATCGCGTGGAAAACATGCCCGCAAGACAACTGGTTTACCATTGCAT
 
. : . : . : . : . : . :
rJMFF003B07- CTGGCGCAAACTCCGANAGGCAGACAGAGCACTTTTGCTCCAGGTGCTCCGAGATGCAGC
JMFN036F12+ CTGGCGCAAACTCCGAGAGGCAGACAGAGCACTTTTGCTCCAGGTGCTCCGAGATGCAGC
JMFN031H20+ CTGGCGCAAACTCCGAGAGGCAGACAGAGCACTTTTGCTCCAGGTGCTCCGAGATGCAGC
                      ____________________________________________________________
consensus CTGGCGCAAACTCCGAGAGGCAGACAGAGCACTTTTGCTCCAGGTGCTCCGAGATGCAGC
 
. : . : . : . : . : . :
rJMFF003B07- AGATCNAATCATACGGGACTGCANGATTTCTGCTGCGGAACTCCTCCATGTAAGCCTCCG
JMFN036F12+ AGATCGAATCATACGGGACTGCAGGATTTCTGGTGCGGAACTCCTCCATGTAAGCCTCCG
JMFN031H20+ AGATCGAATCATACGGGACTGCAGGATTTCTGCTGCGGAACTCCTCCATGTAAGCCTCCG
                      ____________________________________________________________
consensus AGATCGAATCATACGGGACTGCAGGATTTCTGCTGCGGAACTCCTCCATGTAAGCCTCCG
 
. : . : . : . : . : . :
rJMFF003B07- AGGGAGCTCCCCGACATTCAAAACCGTCCAACGGNCCTTCAACGTTGTACTCCTCCCAGG
JMFN036F12+ AGGGAGCTCCCCGACATTCAAAACCGTCCAACGGCCCTTCAACGTTGTACTCCTCCCAGG
JMFN031H20+ AGGGAGCTCCCCGACATTCAAAACCGTCCAACGGCCCTTCAACGTTGTACTCCTCCCAGG
JMFF003B07+ CCTTCAACGTTGTACTCCTCCCAGG
                      ____________________________________________________________
consensus AGGGAGCTCCCCGACATTCAAAACCGTCCAACGGCCCTTCAACGTTGTACTCCTCCCAGG
 
. : . : . : . : . : . :
rJMFF003B07- ACGCTATCCGGATGCCAATGACATGAAGGATTGACCGGACTATCTCCTTCACGATGGAGA
JMFN036F12+ ACGCTATCCGGATGCCAATGCCCCGAAGGATTGACCGGACTATCTCCTTCACGATGGAGA
JMFN031H20+ ACGCTATCCGGATGCCAATGACATGAAGGATTGACCGGACTATCTCCTTCACGATGGAGA
JMFF003B07+ ACGCTATCCGGATGCCAATGACATGAAGGATTGACCGGACTATCTCCTTCACGATGGAGA
                      ____________________________________________________________
consensus ACGCTATCCGGATGCCAATGACATGAAGGATTGACCGGACTATCTCCTTCACGATGGAGA
 
. : . : . : . : . : . :
rJMFF003B07- TGGATATGGCGGT
JMFN036F12+ TGGATATGGCGGTGTTCACCAGTATCACGCATAGCACACCAGCATCCGTTGGAGTAGGAT
JMFN031H20+ TGGATATGGCGGTGTTCACCAGTATCACGCATAGCACACCAGCATCCGTTGGAGTAGGAT
JMFF003B07+ TGGATATGGCGGTGTTCACCAGTATCACGCATAGCACACCAGCATCCGTTGGAGTAGGAT
                      ____________________________________________________________
consensus TGGATATGGCGGTGTTCACCAGTATCACGCATAGCACACCAGCATCCGTTGGAGTAGGAT
 
. : . : . : . : . : . :
JMFN036F12+ AAGTTGAGAGACCCATAATCG
JMFN031H20+ AAGTTGAGAGACCCATAATCGACTTCAACCTTATTGTGGCTTGTAAAGCTGAGTATGCAG
JMFF003B07+ AAGTTGAGAGACCCATAATCGACTTCAACCTTATTGTGGCTTGTAAAGCTGAGTATGCAG
                      ____________________________________________________________
consensus AAGTTGAGAGACCCATAATCGACTTCAACCTTATTGTGGCTTGTAAAGCTGAGTATGCAG
 
. : . : . : . : . : . :
JMFN031H20+ ATTCCTCTGGGCAAAAACCTGTGAGAACAAGCTGGATACAAAGGATCTGCAAAGGGAAGG
JMFF003B07+ ATTCCTNTGGGCAAAAACCTGTGAGAACAAGCTGGATACAAAGGATCTGCAAAGGGAAGG
                      ____________________________________________________________
consensus ATTCCTCTGGGCAAAAACCTGTGAGAACAAGCTGGATACAAAGGATCTGCAAAGGGAAGG
 
. : . : . : . : . : . :
JMFN031H20+ CAGAAAATGGAAACCATATAAGAAACACAGA
JMFF003B07+ CAGAAAATGGAAACCATATAAGAAACACAGAAAAAGCTCACACCAATGAGCCAATCAGAC
                      ____________________________________________________________
consensus CAGAAAATGGAAACCATATAAGAAACACAGAAAAAGCTCACACCAATGAGCCAATCAGAC