Previous Contig 000121:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002P14Sequence379000121 (17)752000121 (17)pir|D96732|D967321e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF003H18Sequence446000121 (17)690000121 (17)pir|D96732|D967321e-32hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF012D08Sequence356000121 (17)763000121 (17)pir|D96732|D967321e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF016D01Sequence479000121 (17)787000121 (17)pir|D96732|D967321e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF017J10Sequence475000121 (17)789000121 (17)pir|D96732|D967322e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF020N04Sequence352000121 (17)752021125gb:AY035159_15599261e-94Arabidopsis thaliana putative chromatin remodelling complex ATPase chain ISWI (A
JMFF035O12Sequence478000121 (17)764000121 (17)pir|D96732|D967321e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF038A04Sequence261000121 (17)738000121 (17)pir|D96732|D967321e-37hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF049K04Sequence630000121 (17)gb:AF428307_17992372e-16Arabidopsis thaliana At1g70780/F5A18_4 mRNA, complete cds.577000121 (17)pir|D96732|D967329e-06hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049K04- GGACCACCCTGGAGAGTTTTTTTTTTTTTTGCXXXXX
                      ____________________________________________________________
consensus GGACCACCCTGGAGAGTTTTTTTTTTTTTTGCNNNNN
 
. : . : . : . : . : . :
rJMFF049K04- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAAAAAAAA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAA
 
. : . : . : . : . : . :
rJMFF049K04- GGGAAAACCTTTTATTCCGGATAATGAACCCTAGCGGAGGGTAGGGAACAATGGCCACCT
rJMFF038A04- TTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF003H18- TTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF002P14- TTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF012D08- TTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF035O12- TTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF016D01- TTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
rJMFF017J10- TTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
                      ____________________________________________________________
consensus GGGAAAACCTTTTATTACGGATAATGAACACTAACAGATGTTAGTGAACAATGTCAACAT
 
. : . : . : . : . : . :
rJMFF049K04- ACCAACAAAAACTAAGGGTAATGGTGCTGATAAAAACAAAGCAAAACAAACCGCCCCCCA
rJMFF038A04- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF003H18- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF002P14- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF012D08- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF035O12- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF016D01- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
rJMFF017J10- AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
                      ____________________________________________________________
consensus AGCAACAGAAACTAATGCTAATGCTGCTGATAAAAACAAAGCAAAACAAACAGCACACCA
 
. : . : . : . : . : . :
rJMFF049K04- GGGCATCCTCCTTATTGAATTCCCTAAAAAGAAATTAAAGAAATTAAAGGGGCCCTTGAA
rJMFF038A04- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF003H18- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF002P14- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF012D08- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF035O12- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF016D01- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
rJMFF017J10- GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
                      ____________________________________________________________
consensus GGGCATCATCCTTATTGAATTCCATAAAAAGAAATTAAAGAAATTAAAGGCGCACTTGAA
 
. : . : . : . : . : . :
rJMFF049K04- GCCCCCCCCTATGTATCATGTATGTAAAACCCTTAAAGGCTTCTACACAAAATCCTCCCC
rJMFF038A04- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF003H18- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF002P14- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF012D08- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF035O12- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF016D01- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
rJMFF017J10- GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
                      ____________________________________________________________
consensus GCCGCCGCCTATGTATCATGTATGTAAAACCTTTAAAGGCTTCTACACAGAATCATCAGC
 
. : . : . : . : . : . :
rJMFF049K04- CCCCCAATAATGGTGGGGCAAGTCTAGGGGGATCCCCAATGGGACAAAACCTTGCGACTG
rJMFF038A04- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF003H18- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF002P14- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF012D08- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF035O12- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF016D01- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
rJMFF017J10- ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
                      ____________________________________________________________
consensus ACCACAATAATGTTGTGGCAAGTCTAGTGGGATCCTCAATGTGACAAGACCTTGCGACTG
 
. : . : . : . : . : . :
rJMFF049K04- AAAAACCTATTGAACCAAAATTTCCAGGTGCCAAACCCCTTGGAAAAATATGCGGGGGCT
rJMFF038A04- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF003H18- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF002P14- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF012D08- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF035O12- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF016D01- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
rJMFF017J10- AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
                      ____________________________________________________________
consensus AGAGACCTATTGAACCAAGATTTCCAGCTGCCAGACCCCTTGCGAACATATGCTGTTGCT
 
. : . : . : . : . : . :
rJMFF049K04- GCCTCTCTTCCTCCATCAAATCTTCTCTCAAAATGGGGCTTCTTGCCCAGCACAAAGTTA
rJMFF038A04- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
rJMFF003H18- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCAAAGCACAAAGTTA
rJMFF002P14- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
rJMFF012D08- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
rJMFF035O12- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
rJMFF016D01- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
rJMFF017J10- GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
                      ____________________________________________________________
consensus GCCTCTCTTCCTCCATCAACTCTTCTCTCAGACTGCGGCTTCTTGCACAGCACAAAGTTA
 
. : . : . : . : . : . :
rJMFF049K04- CCAACCCCAAACGACCCAATTATGTCCCATGGACTCAAAGCTTCCCCCCCAGCATTGGGG
rJMFF038A04- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF003H18- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF002P14- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF012D08- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF035O12- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF016D01- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
rJMFF017J10- CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
                      ____________________________________________________________
consensus CGAACCCCAAACGACCCAATCATGTCCCATGGACTCAGAGCTTCGCTCCCAGCATTGGGG
 
. : . : . : . : . : . :
rJMFF038A04- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF003H18- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF002P14- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF012D08- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF035O12- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF016D01- GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
rJMFF017J10- GAATAGAGAACAAAGTNGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
JMFF049K04+ TAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
                      ____________________________________________________________
consensus GAATAGAGAACAAAGTTGTTAACATCCAAGCCGAGAACCGGCAGGCGTCCCTCCCGAGCA
 
. : . : . : . : . : . :
rJMFF038A04- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF003H18- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF002P14- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF012D08- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF035O12- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF016D01- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
rJMFF017J10- TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
JMFF049K04+ TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
                      ____________________________________________________________
consensus TAAGATTTCAAGGCGGTATCGATCACAGAAGCCACATGTTCTTCCTCACTAACAACGAAC
 
. : . : . : . : . : . :
rJMFF038A04- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF003H18- CGGATAGGGCCGGCGCTTCCGAG-ACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF002P14- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF012D08- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF035O12- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF016D01- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
rJMFF017J10- CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
JMFF035O12+ GTTTAACAAAAGGNGGTTGCCGCCCTTC
JMFF017J10+ TGTTTAACAAAAGGCGGTTGCCGCCCTTC
JMFF016D01+ GTAANGTTTAACAAAAGGNGGTTGCCGCCCTTC
JMFF049K04+ CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
                      ____________________________________________________________
consensus CGGATAGGGCCGGCGCTTCCGAGCACAGTAATGTTTAACAAAAGGCGGTTGCCGCCCTTC
 
. : . : . : . : . : . :
rJMFF038A04- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
rJMFF003H18- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACT
rJMFF002P14- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
rJMFF012D08- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
rJMFF035O12- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
rJMFF016D01- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
rJMFF017J10- CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
JMFF035O12+ CCTACCTGACTTTTTTTNGGNTTGTAAAGCAACNTTTTTNCTCAATTAATCAATCAATCA
JMFF017J10+ CCTACCTGACTTTTTTTNGGNTTGTAAAGCAACNTTTTTNCTCAATTAATCAATCAATCA
JMFF016D01+ CCTACCTGACTTTTTTTNGGNTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCN
JMFF003H18+ TTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
JMFF049K04+ CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
                      ____________________________________________________________
consensus CCTACCTGACTCTTCTTCGGCTTGTAAAGCAACATTTTTACTCAATTAATCAATCAATCA
 
. : . : . : . : . : . :
rJMFF038A04- ATCAAATCCTTTTCGAATGAAAGGATGAG
rJMFF002P14- ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCA
rJMFF012D08- ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCAATTCTTCCGAG
rJMFF035O12- ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCNATTCTTCCGAGA
rJMFF016D01- ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCNATTCCAATTCTTCCGAGAAACAAA
rJMFF017J10- ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCAATTCTTCCGAGAAACAAA
JMFF035O12+ ATCAAATCCTTTTTGAANGAAAGGATGAGTAATTCAATTCCAATTTTTCCGNGAAACAAA
JMFF017J10+ ATCAAATCCTTTTNGAATGAAAGGATGAGTAATTCAATTCCAATTTTTCCGAGAAACAAA
JMFF016D01+ ATCAAATCCTTTTNGAANGAAAGGATGAGTAATTCAATTCCAATTTTTNCGNGAAACAAA
JMFF003H18+ ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCNATTNTTCCGAGAAACAAA
JMFF049K04+ ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCAATTCTTCCGAGAAACAAA
                      ____________________________________________________________
consensus ATCAAATCCTTTTCGAATGAAAGGATGAGTAATTCAATTCCAATTCTTCCGAGAAACAAA
 
. : . : . : . : . : . :
rJMFF016D01- AACNAAGAGT
rJMFF017J10- AACAAAGAGT
JMFF035O12+ AACAAAGAGTTCTNCGAATCCNAGAAAAAACNATCCGGTTTGAAAGGAAATNAGNAAACC
JMFF017J10+ AACAAAGAGTNCTNCGAATCCAAGAAAAAACAATCCGGTTNGAAAGGAAATAAGAAAACC
JMFF016D01+ AACAAAGAGTTCTTCGAATCCAAGAAAAAACNATCCGGTTNGAAAGGAAATAAGAAAACC
JMFF003H18+ AACAAAGNGTTCTTCGNATCCNAGAAAAAACNATCCGGTTNGAAAGGAAATAAGAAAACC
JMFF049K04+ AACAAAGAGTACTACGAATCCAAGAAAAAACAATCCGGTTCGAAAGGAAATAAGAAAACC
JMFF002P14+ GAAAGGAAATNAGAAAACC
                      ____________________________________________________________
consensus AACAAAGAGTTCTTCGAATCCAAGAAAAAACAATCCGGTTTGAAAGGAAATAAGAAAACC
 
. : . : . : . : . : . :
JMFF035O12+ NAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF017J10+ AAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF016D01+ NAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF038A04+ AAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF003H18+ NAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF049K04+ AAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF012D08+ TGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF020N04+ AAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
JMFF002P14+ NAAATGAAAGNAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
                      ____________________________________________________________
consensus AAAATGAAAGAAAAAAAAAACAAACAAAATCACAAGCGAGCAACAAGAGATAAATCTAAG
 
. : . : . : . : . : . :
JMFF035O12+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF017J10+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF016D01+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF038A04+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF003H18+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF049K04+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF012D08+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF020N04+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
JMFF002P14+ GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
                      ____________________________________________________________
consensus GGTCGACGCCTAGGCAGCGGTAGTACCAGCCTTCCTTGCAGGAGCCAAAAGAGAACGAAG
 
. : . : . : . : . : . :
JMFF035O12+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF017J10+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF016D01+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF038A04+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF003H18+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF049K04+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF012D08+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF020N04+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
JMFF002P14+ AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
                      ____________________________________________________________
consensus AAGAAACGGAGACCCCCCTTCTTGGAGAAGAAGACAAGGGGGAGATCATTAACAAATTAC
 
. : . : . : . : . : . :
JMFF035O12+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF017J10+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF016D01+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF038A04+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF003H18+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF049K04+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF012D08+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF020N04+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
JMFF002P14+ TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
                      ____________________________________________________________
consensus TCAGAATTTCCACCATTCACAAACAATCCCGAACCAAGAGATGAATGAAAATAAACAAAA
 
. : . : . : . : . : . :
JMFF035O12+ GAATTGAAAAAGAACCGCTTCAATTT
JMFF017J10+ GAATTGAAAAAGAACCGCTTCAATTT
JMFF016D01+ GAATTGAAAAAGAACCGCTTCAATTT
JMFF038A04+ GAATTGAAAAAGAACCGCTTCAATTT
JMFF003H18+ GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATC
JMFF049K04+ GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATCTC
JMFF012D08+ GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATCTCAGATCTTCGAG
JMFF020N04+ GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATCTCAGATCTTCGAG
JMFF002P14+ GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATCTCAGATCTTCGAG
                      ____________________________________________________________
consensus GAATTGAAAAAGAACCGCTTCAATTTGAAAGAAATAATAACAAGATCTCAGATCTTCGAG
 
. : . : . : . : . : . :
JMFF012D08+ GAGGCTGGTGCTTTATATAATAATGATGAAGGAAGAAGAATTCTGGGA
JMFF020N04+ GAGGCTGGTGCTTTATATAATAATGATGAAGGAAGAAGAATTCTGGGA
JMFF002P14+ GAGGCTGGTGCTTTATATAATAATGATGAAGGAAGAAGAATTCTGGGATGCTGGGAGCCT
                      ____________________________________________________________
consensus GAGGCTGGTGCTTTATATAATAATGATGAAGGAAGAAGAATTCTGGGATGCTGGGAGCCT