Previous Contig 000119:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002P05Sequence488000119 (5)gb:AY085885_15709481e-31Arabidopsis thaliana clone 19314 mRNA, complete sequence.
JMFS129C03Sequence572000119 (5)gb:AY085885_15709482e-42Arabidopsis thaliana clone 19314 mRNA, complete sequence.
JMSF020M06Sequence674000119 (5)gb:AY085885_15709483e-47Arabidopsis thaliana clone 19314 mRNA, complete sequence.771012538 (4)gb:AP004053_18369841e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF027F03Sequence660000119 (5)gb:AY085885_15709482e-46Arabidopsis thaliana clone 19314 mRNA, complete sequence.780012538 (4)gb:ATH316230_15524901e-74Arabidopsis thaliana mRNA for alcohol oxidase (fao3 gene).
JMSF045C24Sequence663000119 (5)gb:AY085885_15709487e-46Arabidopsis thaliana clone 19314 mRNA, complete sequence.773012538 (4)gb:ATH316230_15524902e-78Arabidopsis thaliana mRNA for alcohol oxidase (fao3 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027F03+ T
JMSF045C24+ T
JMSF020M06+ GGTACCATTTTCATT
                      ____________________________________________________________
consensus GGTACCATTTTCATT
 
. : . : . : . : . : . :
JMSF027F03+ TATGGTTTCAATGATACCCTTTTCTAATGGCCTTCCTGTCTGTTGGTCTGGGGGAACTTC
JMSF045C24+ TATGGTTTCAATGATACCCTTTTNTAATGGCCTTCCTGTCTGTTGGTCTGGGGGAACTTC
JMFS129C03+ GGTCTGGGGGAACTTC
JMSF020M06+ TATGGTTTCAATGATACCCTTTTCTAATGGCCTCCCTGTCTGTTGGTCTGGGGGAACTTC
                      ____________________________________________________________
consensus TATGGTTTCAATGATACCCTTTTCTAATGGCCTTCCTGTCTGTTGGTCTGGGGGAACTTC
 
. : . : . : . : . : . :
JMSF027F03+ ATTGGTGTCTACATGGAAGCCAATTGCTTCCCATGCCGGATTATTATAATTTTCATCAGT
JMSF045C24+ ATTGGTGTCTACATGGAAGCCAATTGCTTCCCATGCCGGATTATTATAATTTTCATCAGT
JMFS129C03+ ATTGGTGTCTACATGGAAGCCAATGNCTTCCCATGCCGGATTATTATAATTTTCATCAGT
JMSF020M06+ ATTGGTGTCTACATGGAAGCCAATTGCTTCCCATGCCGGATTATTATAATTTTCATCAGT
                      ____________________________________________________________
consensus ATTGGTGTCTACATGGAAGCCAATTGCTTCCCATGCCGGATTATTATAATTTTCATCAGT
 
. : . : . : . : . : . :
JMSF027F03+ CCATGAGAAGTAAATGAAATAGCAGGCAATTTTGATGGTCATGAACACAATTCTTAGAGG
JMSF045C24+ CCATGAGAAGTAAATGAAATAGCAGGCAATTTTGATGGTCATGAACACAATTCTTAGAGG
JMFS129C03+ CCATGAGAAGTAAATGAAATAGCAGGCAATTTTGATGGTCATGAACACAATTCTTAGAGG
JMSF020M06+ CCATGAGAAGTAAATGAAATAGCAGGCAATTTTGATGGTCATGAACACAATTCTTAGAGG
JMFF002P05+ CTTAGAGG
                      ____________________________________________________________
consensus CCATGAGAAGTAAATGAAATAGCAGGCAATTTTGATGGTCATGAACACAATTCTTAGAGG
 
. : . : . : . : . : . :
JMSF027F03+ AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
JMSF045C24+ AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
JMFS129C03+ AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
JMSF020M06+ AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
JMFF002P05+ AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
                      ____________________________________________________________
consensus AAGTATAAGGGTTTCCCTTGACCATTTCAGGAGAATGGCTTCTCTTCGCTTCAAGGGTAA
 
. : . : . : . : . : . :
JMSF027F03+ CTCAGAGAAGTTGTGAATGAAGGGCCATCTTCCATCAAAGCAAACAAACCCACAAAGAAG
JMSF045C24+ CTCAGAGAAGTTGTGAATGAAGGGCCATCTTCCATCAAAGCAAACAAACCCACAAAGAAG
JMFS129C03+ CTCAGAGAAGTTGTGAATGAAGGGCCATTTTCCATCAAAGCAAACAAACCCACAAAGAAG
JMSF020M06+ CTCAGAGAAGTTGTGAATGAAGGGCCATCTTCCATCAAAGCAAACAAACCCACAAAGAAG
JMFF002P05+ CTCAGAGAAGTTGTGAATGAAGGGCCATCTTCCATCAAAGCAAACAAACCCACAAAGAAG
                      ____________________________________________________________
consensus CTCAGAGAAGTTGTGAATGAAGGGCCATCTTCCATCAAAGCAAACAAACCCACAAAGAAG
 
. : . : . : . : . : . :
JMSF027F03+ AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
JMSF045C24+ AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
JMFS129C03+ AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
JMSF020M06+ AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
JMFF002P05+ AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
                      ____________________________________________________________
consensus AAGACTACCCAGTCTGGTAGATAGAATAATCAGAACCAATCTGAATATAAACACTGCATC
 
. : . : . : . : . : . :
JMSF027F03+ AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
JMSF045C24+ AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
JMFS129C03+ AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
JMSF020M06+ AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
JMFF002P05+ AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
                      ____________________________________________________________
consensus AGGTAAGAACCTCCTCATCACCACCTCTGCTACCTCATCAGGGAAAGGAGGCTGAGAGGC
 
. : . : . : . : . : . :
JMSF027F03+ TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
JMSF045C24+ TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
JMFS129C03+ TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
JMSF020M06+ TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
JMFF002P05+ TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
                      ____________________________________________________________
consensus TGAAGAGCTGTAGAAGGAACACATAGCTTCATCATCGGAATCTTGAGGGAGTGGAATGGG
 
. : . : . : . : . : . :
JMSF027F03+ AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
JMSF045C24+ AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
JMFS129C03+ AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
JMSF020M06+ AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
JMFF002P05+ AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
                      ____________________________________________________________
consensus AGGTATGAGAGCTTCGCAAATAGCAGCTAAAGCTTGATACTGAGATGAAGACAGGCCATG
 
. : . : . : . : . : . :
JMSF027F03+ ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
JMSF045C24+ ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
JMFS129C03+ ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
JMSF020M06+ ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
JMFF002P05+ ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
                      ____________________________________________________________
consensus ATTATAGCTGTTTCTCCTTCCTCCTCTCAACAATGGATGGCATTTTCTTTCATTCATCTT
 
. : . : . : . : . : . :
JMSF027F03+ TTTCTCTCTCTTGAAAATCTTTTCCCCCTCTCTCTCTCTTTCTCTTTGCTTTGCGG
JMSF045C24+ TTTCTCTCTCTTGAAAATCTTTTCCCCCTCTCTCTCTCTTTCTCTTTGCTTTGCGG
JMFS129C03+ TTTCTCTCTCTTGAAA
JMSF020M06+ TTTCTCTCTCTTGAAAATCTTTTCCCCCTCTCTCTCTCTTTCTCTTTGCTTTGCGG
JMFF002P05+ TTTCTCTCTCTTGAAAATCTTTTCCCCCTCTCTCTCTCTTTCTCTTTGCTTTGCGGTTAT
                      ____________________________________________________________
consensus TTTCTCTCTCTTGAAAATCTTTTCCCCCTCTCTCTCTCTTTCTCTTTGCTTTGCGGTTAT