Previous Contig 000114:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O04Sequence399000114 (10)721011063 (5)gb:AY136385_15818863e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFF021I24Sequence522000114 (10)247011063 (5)
JMFF051D17Sequence624000114 (10)gb:AY371292_16030554e-11Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.551011063 (5)gb:AY136385_15818862e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFF051P21Sequence624000114 (10)gb:AY371292_16030556e-07Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.558011063 (5)gb:AY136385_15818862e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFS121B03Sequence570000114 (10)gb:AY371292_16030553e-09Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMFS152D01Sequence620000114 (10)gb:AY371292_16030551e-20Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMFS167G03Sequence599000114 (10)gb:AY371292_16030552e-15Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMSF012O21Sequence310000114 (10)716012603 (2)gb:AY371292_16030551e-27Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMSF028G17Sequence680000114 (10)gb:AY371292_16030554e-24Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.694012603 (2)gb:AY371292_16030554e-28Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMSF033A06Sequence703000114 (10)gb:AY371292_16030557e-25Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.714023558gb:AY371292_16030557e-16Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033A06+ GTGGCTGTAGCACTCAAGGCAGCTTTAACGGGTTGTCCTCTGATTGCCACGAG
                      ____________________________________________________________
consensus GTGGCTGTAGCACTCAAGGCAGCTTTAACGGGTTGTCCTCTGATTGCCACGAG
 
. : . : . : . : . : . :
JMSF033A06+ CTGTTTTGGGCTCTTATGTTGTCTTGTGTTTATTCCAATATTGAGCTTTGAACCTTTATT
                      ____________________________________________________________
consensus CTGTTTTGGGCTCTTATGTTGTCTTGTGTTTATTCCAATATTGAGCTTTGAACCTTTATT
 
. : . : . : . : . : . :
JMSF033A06+ AGGACAAACTGAAGCAGCCGGACTCGATGGAGCAAGTTTTTCCCAATCTGATTTACTATA
                      ____________________________________________________________
consensus AGGACAAACTGAAGCAGCCGGACTCGATGGAGCAAGTTTTTCCCAATCTGATTTACTATA
 
. : . : . : . : . : . :
JMSF033A06+ AAATTTCCCCGGACCTTGATCTGTACTAGAGTTGACAATGATGCAAACTCTTGAATCATC
                      ____________________________________________________________
consensus AAATTTCCCCGGACCTTGATCTGTACTAGAGTTGACAATGATGCAAACTCTTGAATCATC
 
. : . : . : . : . : . :
JMSF033A06+ TCCAACCGCTTTCTTTCTGGATTCAAACTGTGTCAGCTGAGTAGAATCAGAACAGCAAGC
                      ____________________________________________________________
consensus TCCAACCGCTTTCTTTCTGGATTCAAACTGTGTCAGCTGAGTAGAATCAGAACAGCAAGC
 
. : . : . : . : . : . :
JMSF033A06+ ATGTAACTTCTCAGCTGAGGTTCTCGATGAAGGCAAATGCAATGGAAACAGCATATCCCT
                      ____________________________________________________________
consensus ATGTAACTTCTCAGCTGAGGTTCTCGATGAAGGCAAATGCAATGGAAACAGCATATCCCT
 
. : . : . : . : . : . :
JMSF033A06+ TTCATGTCCATTACCCTGAGGAATCAAATTGGGGTTGAAACGCTGAGAAGGGATGCTAAG
JMFF051P21+ CCATGATCAAATCGCTGAGAGGGGATGCTGAG
JMSF028G17+ CGCTGAGAGGGGATGCTGAG
JMFS152D01+ CGCTGAGAGGGGATGCTGAG
JMFS167G03+ TGATCAAATCGCTGAGAGGGGATGCTGAG
JMFF051D17+ CCATGATCAAATCGCTGAGAGGGGATGCTGAG
                      ____________________________________________________________
consensus TTCATGTCCATTACCCTGAGGAATCAAACCATGATCAAATCGCTGAGAGGGGATGCTGAG
 
. : . : . : . : . : . :
JMSF033A06+ CTGCTCATAGAGGGCCATCTTGTTCCTTGGAGGAGCCCTTGGTCCTCCCTTCTCAGTATC
JMFF051P21+ CTGCTCATAGAGAGCCATCTGTTTCC-TGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
JMSF028G17+ CTGCTCATAGAGAGCCATCTTGTTCCTTGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
JMFS152D01+ CTGCTCATAGAGAGCCATCTTGTTCCTTGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
JMFS167G03+ CTGCTCATAGAGAGCCATCTTGTTCCTTGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
JMFS121B03+ AGCCATCTTGTTCCTTGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
JMFF051D17+ CTGCTCATAGAGAGCCATCTTGTTCC-TGGAGGAGCTCTNGGTCCTCCCTTTTCAGTATC
                      ____________________________________________________________
consensus CTGCTCATAGAGAGCCATCTTGTTCCTTGGAGGAGCTCTTGGTCCTCCCTTTTCAGTATC
 
. : . : . : . : . : . :
JMSF033A06+ ATTCACATGAAGCCTTGGGAACATTGGTCCCAT
JMFF051P21+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMSF028G17+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMFS152D01+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMFS167G03+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMFS121B03+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMFF051D17+ ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
JMFF021I24+ AAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
                      ____________________________________________________________
consensus ATTAACATGAAGCCTTGGAAACATTGGCCCCATTATTTTCTCCTCACCTTTCCCTCTCTT
 
. : . : . : . : . : . :
JMFF051P21+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMSF028G17+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMFS152D01+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMFS167G03+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMFS121B03+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMFF051D17+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
JMFF021I24+ CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
                      ____________________________________________________________
consensus CATCTTCTCTCTAGATTCAACCAGTCTCAAAACATCGAGAGCCAAACCACTTGCTAAAAT
 
. : . : . : . : . : . :
JMFF051P21+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMSF028G17+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFS152D01+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFS167G03+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFS121B03+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFF051D17+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFF021I24+ CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMSF012O21+ AAAAAATCCACAACTCGCAGAACAGCGTAAATCA
JMFF002O04+ CACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
                      ____________________________________________________________
consensus CCCCACTTTAAAATCAACCCGCACATAAAAAATCCACAACTCGCAGAACAGCGTAAATCA
 
. : . : . : . : . : . :
JMFF051P21+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMSF028G17+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFS152D01+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFS167G03+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFS121B03+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFF051D17+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFF021I24+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMSF012O21+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
JMFF002O04+ GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
                      ____________________________________________________________
consensus GATTCAGTTGAGCTTAGAAATTGGGATTCACAGGCTGAAACGACATAAATCGATTCTTCT
 
. : . : . : . : . : . :
JMFF051P21+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMSF028G17+ GCACAAAATCCGGGCAAACCCGCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFS152D01+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFS167G03+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFS121B03+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFF051D17+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFF021I24+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMSF012O21+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
JMFF002O04+ GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
                      ____________________________________________________________
consensus GCACAAAATCCGGGCAAACCCCCAATTTCAGAAACGCAAGAGACTCTTCAAACCCAGTAA
 
. : . : . : . : . : . :
JMFF051P21+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMSF028G17+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFS152D01+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFS167G03+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFS121B03+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFF051D17+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFF021I24+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMSF012O21+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
JMFF002O04+ CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
                      ____________________________________________________________
consensus CCCGAAATCGATTCCAACAGCCTAAGAGTCAACTTTTTTTCCTGTTCTTTTCTTTTCTAA
 
. : . : . : . : . : . :
JMFF051P21+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMSF028G17+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFS152D01+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFS167G03+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFS121B03+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFF051D17+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFF021I24+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMSF012O21+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
JMFF002O04+ GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
                      ____________________________________________________________
consensus GAATATCCGAGGAAACAAAGACCAAAACAATGAAACGAGAACAGATTCGAGAGATTGTAA
 
. : . : . : . : . : . :
JMFF051P21+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
JMSF028G17+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAG
JMFS152D01+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGC
JMFS167G03+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
JMFS121B03+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
JMFF051D17+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
JMFF021I24+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
JMSF012O21+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGG
JMFF002O04+ AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
                      ____________________________________________________________
consensus AAGAAAGAGGAAAAGTTTATCGATTCTTGAAGGGCAAAAAAGGAGAGGATCGAAAGAGAA
 
. : . : . : . : . : . :
JMFF051P21+ GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGTGGACCCAAATG
JMFS167G03+ GAAGCTATGT-AAAAGGGATACGGCAAAAGT
JMFS121B03+ GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGT
JMFF051D17+ GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGTGGACCCAAATG
JMFF021I24+ GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGTGGACCCAAATG
JMFF002O04+ GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGTGGACCCAAATGTGGATAG
                      ____________________________________________________________
consensus GAAGCTATGTGAAAAGGGATACGGCAAAAGTGCTTAGTTTGTGGACCCAAATGTGGATAG